RegulonDB RegulonDB 10.9: Gene Sequence
ppsA gene sequence


Size: 2379        A: 542  T: 537  G: 693  C: 607

Fasta

 

>ppsA E. coli K12. Version NC_000913.3 GI:556503834
atgtccaacaatggctcgtcaccgctggtgctttggtataaccaactcggcatgaatgat
gtagacagggttgggggcaaaaatgcctccctgggtgaaatgattactaatctttccgga
atgggtgtttccgttccgaatggtttcgccacaaccgccgacgcgtttaaccagtttctg
gaccaaagcggcgtaaaccagcgcatttatgaactgctggataaaacggatattgacgat
gttactcagcttgcgaaagcgggcgcgcaaatccgccagtggattatcgacactcccttc
cagcctgagctggaaaacgccatccgcgaagcctatgcacagctttccgccgatgacgaa
aacgcctcttttgcggtgcgctcctccgccaccgcagaagatatgccggacgcttctttt
gccggtcagcaggaaaccttcctcaacgttcagggttttgacgccgttctcgtggcagtg
aaacatgtatttgcttctctgtttaacgatcgcgccatctcttatcgtgtgcaccagggt
tacgatcaccgtggtgtggcgctctccgccggtgttcaacggatggtgcgctctgacctc
gcatcatctggcgtgatgttctccattgataccgaatccggctttgaccaggtggtgttt
atcacttccgcatggggccttggtgagatggtcgtgcagggtgcggttaacccggatgag
ttttacgtgcataaaccgacactggcggcgaatcgcccggctatcgtgcgccgcaccatg
gggtcgaaaaaaatccgcatggtttacgcgccgacccaggagcacggcaagcaggttaaa
atcgaagacgtaccgcaggaacagcgtgacatcttctcgctgaccaacgaagaagtgcag
gaactggcaaaacaggccgtacaaattgagaaacactacggtcgcccgatggatattgag
tgggcgaaagatggccacaccggtaaactgttcattgtgcaggcgcgtccggaaaccgtg
cgctcacgcggtcaggtcatggagcgttatacgctgcattcacagggtaagattatcgcc
gaaggccgtgctatcggtcatcgcatcggtgcgggtccggtgaaagtcatccatgacatc
agcgaaatgaaccgcatcgaacctggcgacgtgctggttactgacatgaccgacccggac
tgggaaccgatcatgaagaaagcatctgccatcgtcaccaaccgtggcggtcgtacctgt
cacgcggcgatcatcgctcgtgaactgggcattccggcggtagtgggctgtggagatgca
acagaacggatgaaagacggtgagaacgtcactgtttcttgtgccgaaggtgataccggt
tacgtctatgcggagttgctggaatttagcgtgaaaagctccagcgtagaaacgatgccg
gatctgccgttgaaagtgatgatgaacgtcggtaacccggaccgtgctttcgacttcgcc
tgcctaccgaacgaaggcgtgggccttgcgcgtctggaatttatcatcaaccgtatgatt
ggcgtccacccacgcgcactgcttgagtttgacgatcaggaaccgcagttgcaaaacgaa
atccgcgagatgatgaaaggttttgattctccgcgtgaattttacgttggtcgtctgact
gaagggatcgcgacgctgggtgccgcgttttatccgaagcgcgtcattgtccgtctctct
gattttaaatcgaacgaatatgccaacctggtcggtggtgagcgttacgagccagatgaa
gagaacccgatgctcggcttccgtggcgcgggccgctatgtttccgacagcttccgcgac
tgtttcgcgctggagtgtgaagcagtgaaacgtgtgcgcaacgacatgggactgaccaac
gttgagatcatgatcccgttcgtgcgtaccgtagatcaggcgaaagcggtggttgaagaa
ctggcgcgtcaggggctgaaacgtggcgagaacgggctgaaaatcatcatgatgtgtgaa
atcccgtccaacgccttgctggccgagcagttcctcgaatatttcgacggcttctcaatt
ggctcaaacgatatgacgcagctggcgctcggtctggaccgtgactccggcgtggtgtct
gaattgttcgatgagcgcaacgatgcggtgaaagcactgctgtcgatggctatccgtgcc
gcgaagaaacagggcaaatatgtcgggatttgcggtcagggtccgtccgaccacgaagac
tttgccgcatggttgatggaagaggggatcgatagcctgtctctgaacccggacaccgtg
gtgcaaacctggttaagcctggctgaactgaagaaataa
              
                            

Download fasta file
RegulonDB