RegulonDB RegulonDB 10.9: Gene Sequence
prc gene sequence


Size: 2049        A: 548  T: 469  G: 562  C: 470

Fasta

 

>prc E. coli K12. Version NC_000913.3 GI:556503834
atgaacatgttttttaggcttaccgcgttagctggcctgcttgcaatagcaggccagacc
ttcgctgtagaagatatcacgcgtgctgatcaaattccggtattaaaggaagagacgcag
catgcgacggtaagtgagcgcgtaacgtcgcgcttcacccgttctcattatcgccagttc
gacctcgatcaggcattttcggccaaaatctttgaccgctacctgaatctgctcgattac
agccacaacgtgctgctggcaagcgatgttgaacagttcgcgaaaaagaaaaccgagtta
ggcgatgaactgcgttcaggcaaactcgacgttttctacgatctctacaatctggcgcaa
aagcgccgttttgagcgttaccagtacgctttgtcggtactggaaaagccgatggatttc
accggcaacgacacttataaccttgaccgcagcaaagcgccctggccgaaaaacgaggct
gagttgaacgcgctgtgggacagtaaagtcaaattcgacgagttaagcctgaagctgaca
ggaaaaacggataaagaaattcgtgaaaccctgactcgccgctacaaatttgccattcgt
cgtctggcgcaaaccaacagcgaagatgttttctcgctggcaatgacggcgtttgcgcgt
gaaatcgacccgcataccaactatctttccccgcgtaataccgaacagttcaacactgaa
atgagtttgtcgctggaaggtattggcgcagtgctgcaaatggatgatgactacaccgtt
atcaattcgatggtggcaggtggtccggcagcgaagagtaaagctatcagcgttggtgac
aaaattgtcggtgttggtcaaacaggcaagccgatggttgacgtgattggctggcgtctt
gatgatgtggttgccttaattaaagggccgaagggcagtaaagttcgtctggaaatttta
cctgctggtaaagggaccaagacccgtactgtaacgttgacccgtgaacgtattcgtctc
gaagaccgcgcggttaaaatgtcggtgaagaccgtcggtaaagagaaagtcggcgtgctg
gatattccgggcttctatgtgggtttgacagacgatgtcaaagtgcaactgcagaaactg
gaaaaacagaatgtcagcagcgtcatcatcgacctgcgtagcaatggcggtggggcgtta
actgaagccgtatcgctctccggtctgtttattcctgcgggtcccattgttcaggtccgc
gataacaacggcaaggttcgtgaagatagcgataccgacggacaggttttctataaaggc
ccgctggtggtgctggttgaccgcttcagtgcttcggcttcagaaatctttgccgcggca
atgcaggattacggtcgtgcgctggttgtgggtgaaccgacgtttggtaaaggcaccgtt
cagcaataccgttcattgaaccgtatttacgatcagatgttacgtcctgaatggccagcg
ctgggttctgtgcagtacacgatccagaaattctatcgcgttaacggcggcagtacgcaa
cgtaaaggcgtaacgccagacatcatcatgccgacgggtaatgaagaaacggaaacgggt
gagaaattcgaagataacgcgctgccgtgggatagcattgatgccgcgacttatgtgaaa
tcaggagatttaacggcctttgaaccggagctgctgaaggaacataatgcgcgtatcgcg
aaagatcctgagttccagaacatcatgaaggatatcgcgcgcttcaacgctatgaaggac
aagcgcaatatcgtttctctgaattacgctgtgcgtgagaaagagaataatgaagatgat
gcgacgcgtctggcgcgtttgaacgaacgctttaaacgcgaaggtaaaccggagttgaag
aaactggatgatctaccgaaagattaccaggagccggatccttatctggatgagacggtg
aatatcgcactcgatctggcgaagcttgaaaaagccagacccgcggaacaacccgctccc
gtcaagtaa
              
                            

Download fasta file
RegulonDB