RegulonDB RegulonDB 10.10: Gene Sequence
prfA gene sequence


Size: 1083        A: 276  T: 233  G: 298  C: 276

Fasta

 

>prfA E. coli K12. Version NC_000913.3 GI:556503834
atgaagccttctatcgttgccaaactggaagccctgcatgaacgccatgaagaagttcag
gcgttgctgggtgacgcgcaaactatcgccgaccaggaacgttttcgcgcattatcacgc
gaatatgcgcagttaagtgatgtttcgcgctgttttaccgactggcaacaggttcaggaa
gatatcgaaaccgcacagatgatgctcgatgatcctgaaatgcgtgagatggcgcaggat
gaactgcgcgaagctaaagaaaaaagcgagcaactggaacagcaattacaggttctgtta
ctgccaaaagatcctgatgacgaacgtaacgccttcctcgaagtccgagccggaaccggc
ggcgacgaagcggcgctgttcgcgggcgatctgttccgtatgtacagccgttatgccgaa
gcccgccgctggcgggtagaaatcatgagcgccagcgagggtgaacatggtggttataaa
gagatcatcgccaaaattagcggtgatggtgtgtatggtcgtctgaaatttgaatccggc
ggtcatcgcgtgcaacgtgttcctgctacggaatcgcagggtcgtattcatacttctgct
tgtaccgttgcggtaatgccagaactgcctgacgcagaactgccggacatcaacccagca
gatttacgcattgatactttccgctcgtcaggggcgggtggtcagcacgttaacaccacc
gattcggcaattcgtattactcacttgccgaccgggattgttgttgaatgtcaggacgaa
cgttcacaacataaaaacaaagctaaagcactttctgttctcggtgctcgcatccacgct
gctgaaatggcaaaacgccaacaggccgaagcgtctacccgtcgtaacctgctggggagt
ggcgatcgcagcgaccgtaaccgtacttacaacttcccgcaggggcgcgttaccgatcac
cgcatcaacctgacgctctaccgcctggatgaagtgatggaaggtaagctggatatgctg
attgaaccgattatccaggaacatcaggccgaccaactggcggcgttgtccgagcaggaa
taa
              
                            

Download fasta file
RegulonDB