RegulonDB RegulonDB 10.9: Gene Sequence
priC gene sequence


Size: 528        A: 116  T: 101  G: 162  C: 149

Fasta

 

>priC E. coli K12. Version NC_000913.3 GI:556503834
gtgaaaaccgccctgctgctggaaaaactggaaggacagctcgctacgctgcgtcagcgt
tgtgccccggtgtcacagttcgccacgctaagtgctcgtttcgacaggcatctttttcag
actcgtgcgacaacactacaggcttgtctcgacgaggcgggcgataatctggctgcgctt
cgtcatgcagttgagcagcaacagctgccgcaagtggcctggctggcggaacatctggcg
gcacaactggaagccatcgcgcgtgaagcctccgcctggtcattgcgcgagtgggacagt
gcaccaccgaaaattgcccgctggcagcgtaaacgtattcagcatcaggattttgagcgg
cggctacgtgagatggttgccgaacgcagagcccgtctggcgcgggtgaccgatctcgtg
gaacagcaaacgctgcatcgtgaagtggaagcctatgaagcgcgcctggcacgctgccgc
catgcgctggaaaaaatcgaaaacaggttagcgcgtttaacccgctag
              
                            

Download fasta file
RegulonDB