RegulonDB RegulonDB 11.0: Gene Sequence
proA gene sequence


Size: 1254        A: 306  T: 267  G: 366  C: 315

Fasta

 

>proA E. coli K12. Version NC_000913.3 GI:556503834
atgctggaacaaatgggcattgccgcgaagcaagcctcgtataaattagcgcaactctcc
agccgcgaaaaaaatcgcgtgctggaaaaaatcgccgatgaactggaagcacaaagcgaa
atcatcctcaacgctaacgcccaggatgttgctgacgcgcgagccaatggccttagcgaa
gcgatgcttgaccgtctggcactgacgcccgcacggctgaaaggcattgccgacgatgta
cgtcaggtgtgcaacctcgccgatccggtggggcaggtaatcgatggcggcgtactggac
agcggcctgcgtcttgagcgtcgtcgcgtaccgctgggggttattggcgtgatttatgaa
gcgcgcccgaacgtgacggttgatgtcgcttcgctgtgcctgaaaaccggtaatgcggtg
atcctgcgcggtggcaaagaaacgtgtcgcactaacgctgcaacggtggcggtgattcag
gacgccctgaaatcctgcggcttaccggcgggtgccgtgcaggcgattgataatcctgac
cgtgcgctggtcagtgaaatgctgcgtatggataaatacatcgacatgctgatcccgcgt
ggtggcgctggtttgcataaactgtgccgtgaacagtcgacaatcccggtgatcacaggt
ggtataggcgtatgccatatttacgttgatgaaagtgtagagatcgctgaagcattaaaa
gtgatcgtcaacgcgaaaactcagcgtccgagcacatgtaatacggttgaaacgttgctg
gtgaataaaaacatcgccgatagcttcctgcccgcattaagcaaacaaatggcggaaagc
ggcgtgacattacacgcagatgcagctgcactggcgcagttgcaggcaggccctgcgaag
gtggttgctgttaaagccgaagagtatgacgatgagtttctgtcattagatttgaacgtc
aaaatcgtcagcgatcttgacgatgccatcgcccatattcgtgaacacggcacacaacac
tccgatgcgatcctgacccgcgatatgcgcaacgcccagcgttttgttaacgaagtggat
tcgtccgctgtttacgttaacgcctctacgcgttttaccgacggcggccagtttggtctg
ggtgcggaagtggcggtaagcacacaaaaactccacgcgcgtggcccaatggggctggaa
gcactgaccacttacaagtggatcggcattggtgattacaccattcgtgcgtaa
              
                            

Download fasta file
RegulonDB