RegulonDB RegulonDB 10.9: Gene Sequence
proB gene sequence


Size: 1104        A: 243  T: 240  G: 326  C: 295

Fasta

 

>proB E. coli K12. Version NC_000913.3 GI:556503834
atgagtgacagccagacgctggtggtaaaactcggcaccagtgtgctaacaggcggatcg
cgccgtctgaaccgtgcccatatcgttgaacttgttcgccagtgcgcgcagttacatgcc
gccgggcatcggattgttattgtgacgtcgggcgcgatcgccgccggacgtgagcacctg
ggttacccggaactgccagcgaccatcgcctcgaaacaactgctggcggcggtagggcag
agtcgactgattcaactgtgggaacagctgttttcgatttatggcattcacgtcgggcaa
atgctgctgacccgtgctgatatggaagaccgtgaacgcttcctgaacgcccgcgacacc
ctgcgagcgttgctcgataacaatatcgttccggtaatcaatgagaacgatgctgtcgct
acggcagagattaaggtcggcgataacgataacctttctgcgctggcggcgattcttgcg
ggtgccgataaactgttgctgctgaccgatcaaaaaggtttgtataccgctgacccgcgc
agcaatccgcaggcagaactgattaaagatgtttacggcattgatgacgcactgcgcgcg
attgccggtgacagcgtttcaggcctcggaactggcggcatgagtaccaaattgcaggcc
gctgacgtggcttgccgtgcgggtatcgacaccattattgccgcgggcagcaagccgggc
gttattggtgatgtgatggaaggcatttccgtcggtacgctgttccatgcccaggcgact
ccgcttgaaaaccgtaaacgctggattttcggtgcgccgccggcgggtgaaatcacggta
gatgaaggggcaactgccgccattctggaacgcggcagctccctgttgccgaaaggcatt
aaaagcgtgactggcaatttctcgcgtggtgaagtcatccgcatttgcaacctcgaaggc
cgcgatatcgcccacggcgtcagtcgttacaacagcgatgcattacgccgtattgccgga
caccactcgcaagaaattgatgcaatactgggatatgaatacggcccggttgccgttcac
cgtgatgacatgattacccgttaa
              
                            

Download fasta file
RegulonDB