RegulonDB RegulonDB 10.9: Gene Sequence
proC gene sequence


Size: 810        A: 197  T: 171  G: 228  C: 214

Fasta

 

>proC E. coli K12. Version NC_000913.3 GI:556503834
atggaaaagaaaatcggttttattggctgcggcaatatgggaaaagccattctcggcggt
ctgattgccagcggtcaggtgcttccagggcaaatctgggtatacaccccctccccggat
aaagtcgccgccctgcatgaccagttcggcatcaacgccgcagaatcggcgcaagaagtg
gcgcaaatcgccgacatcatttttgctgccgttaaacctggcatcatgattaaagtgctt
agcgaaatcacctccagcctgaataaagactctctggtcgtttctattgctgcaggtgtc
acgctcgaccagcttgcccgcgcgctgggccatgaccggaaaattatccgcgccatgccg
aacactcccgcactggttaatgccgggatgacctccgtaacgccaaacgcgctggtaacc
ccagaagataccgctgatgtgctgaatattttccgctgctttggcgaagcggaagtaatt
gctgagccgatgatccacccggtggtcggtgtgagcggttcttcgccagcctacgtattt
atgtttatcgaagcgatggccgacgccgccgtgctgggcgggatgccacgcgcccaggcg
tataaatttgccgctcaggcggtaatgggttccgcaaaaatggtgctggaaacgggagaa
catccgggggcactgaaagatatggtctgctcaccgggaggcaccaccattgaagcggta
cgcgtactggaagagaaaggcttccgtgctgcagtgatcgaagcgatgacgaagtgtatg
gaaaaatcagaaaaactcagcaaatcctga
              
                            

Download fasta file
RegulonDB