RegulonDB RegulonDB 10.10: Gene Sequence
proV gene sequence


Size: 1203        A: 319  T: 294  G: 313  C: 277

Fasta

 

>proV E. coli K12. Version NC_000913.3 GI:556503834
atggcaattaaattagaaattaaaaatctttataaaatatttggcgagcatccacagcga
gcgttcaaatatatcgaacaaggactttcaaaagaacaaattctggaaaaaactgggcta
tcgcttggcgtaaaagacgccagtctggccattgaagaaggcgagatatttgtcatcatg
ggattatccggctcgggtaaatccacaatggtacgccttctcaatcgcctgattgaaccc
acccgcgggcaagtgctgattgatggtgtggatattgccaaaatatccgacgccgaactc
cgtgaggtgcgcagaaaaaagattgcgatggtcttccagtcctttgccttaatgccgcat
atgaccgtgctggacaatactgcgttcggtatggaattggccggaattaatgccgaagaa
cgccgggaaaaagcccttgatgcactgcgtcaggtcgggctggaaaattatgcccacagc
tacccggatgaactctctggcgggatgcgtcaacgtgtgggattagcccgcgcgttagcg
attaatccggatatattattaatggacgaagccttctcggcgctcgatccattaattcgc
accgagatgcaggatgagctggtaaaattacaggcgaaacatcagcgcaccattgtcttt
atttcccacgatcttgatgaagccatgcgtattggcgaccgaattgccattatgcaaaat
ggtgaagtggtacaggtcggcacaccggatgaaattctcaataatccggcgaatgattat
gtccgtaccttcttccgtggcgttgatattagtcaggtattcagtgcgaaagatattgcc
cgccggacaccgaatggcttaattcgtaaaacccctggcttcggcccacgttcggcactg
aaattattgcaggatgaagatcgcgaatatggctacgttatcgaacgcggtaataagttt
gtcggcgcagtctccatcgattcgcttaaaaccgcgttaacgcagcagcaaggtcttgat
gcggcgctgattgatgcgccgttagcagtcgatgcacaaacgcctcttagcgagttgctc
tctcatgtcggacaggcaccctgtgcggtgcccgtggtcgacgaggaccaacagtatgtc
ggcatcatttcgaaaggaatgctgctgcgcgctttagatcgtgagggggtaaataatggc
tga
              
                            

Download fasta file
RegulonDB