RegulonDB RegulonDB 10.10: Gene Sequence
proW gene sequence


Size: 1065        A: 176  T: 270  G: 320  C: 299

Fasta

 

>proW E. coli K12. Version NC_000913.3 GI:556503834
atggctgatcaaaataatccgtgggataccacgccagcggcggacagtgccgcgcaatcc
gcagacgcctggggtacaccgacgactgcaccgactgacggcggtggtgctgactggctg
accagtacgcctgcgccaaacgtcgagcattttaatattctcgatccgttccataaaacg
ctgatcccgctcgacagttgggtcactgaagggatcgactgggtcgttacccatttccgt
cccgtcttccagggcgtgcgcgttccggttgattatatcctcaacggtttccagcaattg
ctgctgggtatgcccgcaccggtggcgattatcgttttcgctctcatcgcctggcagatt
tccggggtcggaatgggtgtggcgacgctggtttcgctgattgccatcggcgcaatcggt
gcctggtcgcaggcaatggtgactctggcgctggtgttaaccgccctgctgttctgtatc
gtcatcggtttgccgttggggatatggctggcgagaagtccgcgagcggcgaaaattatt
cgtccactgcttgatgccatgcagaccacgccagcgtttgtttatctggtgccaatcgtc
atgctatttggtatcggtaacgtgccgggcgtggtggtgacgatcatctttgctctgccg
ccgattatccgtctgaccattctggggattaaccaggttccggcggatctgattgaagcc
tcgcgctcattcggtgccagcccgcgccagatgctgttcaaagttcagttaccgctggcg
atgccgaccattatggcgggcgttaaccagacgctgatgctggccctttctatggtggtc
atcgcctcgatgattgccgtcggcgggttgggtcagatggtacttcgcggtatcggtcgt
ctggatatggggcttgccaccgttggcggcgtcgggattgtgatcctcgccattatcctc
gatcgtctgacgcaggccgttgggcgcgactcacgcagtcgcggcaaccgtcgctggtac
accactggccctgttggtctgctgacccgcccattcattaagtaa
              
                            

Download fasta file
RegulonDB