RegulonDB RegulonDB 10.10: Gene Sequence
pspA gene sequence


Size: 669        A: 208  T: 131  G: 187  C: 143

Fasta

 

>pspA E. coli K12. Version NC_000913.3 GI:556503834
atgggtattttttctcgctttgccgacatcgtgaatgccaacatcaacgctctgttagag
aaagcggaagatccacagaaactggttcgtctgatgatccaggagatggaagatacactg
gttgaagtacgttctacttcggcgcgcgcgttggcagaaaagaaacagctgactcgccgt
attgaacaagcgtcggcgcgtgaggttgaatggcaggaaaaagccgaactggcgctgctg
aaagagagagaggatctggcacgtgcagcgttaattgaaaaacagaaactgaccgatctg
attaagtccctggaacatgaagtgacgctggtggacgatacgctggcacgcatgaagaaa
gagattggcgagctggaaaacaaattgagcgaaacacgcgctcgccagcaggcattgatg
ttacgtcatcaggcggcaaactcgtcgcgcgatgtgcgtcgtcagctggacagtggcaaa
ctggatgaagcaatggctcgtttcgaatctttcgaacgtcgtattgaccagatggaagcg
gaagcagaaagccacagcttcggtaaacaaaaatcgctggacgatcagtttgccgaactg
aaagccgatgatgcaatcagcgaacaactggcacaattaaaagccaaaatgaagcaagac
aatcaataa
              
                            

Download fasta file
RegulonDB