RegulonDB RegulonDB 11.1: Gene Sequence
pspB gene sequence


Size: 225        A: 54  T: 64  G: 60  C: 47

Fasta

 

>pspB E. coli K12. Version NC_000913.3 GI:556503834
atgagcgcgctatttctggctattccgttaaccatttttgtgctgtttgttttaccgatc
tggttatggctgcattacagcaatcgttctggtcgcagtgaattgtcgcaaagtgagcag
cagcgattagcgcaactggctgatgaagcaaaacggatgcgcgaacgtattcaggcgctg
gaatctattcttgatgcagaacatccgaactggagggatcgctaa
              
                            

Download fasta file
RegulonDB