RegulonDB RegulonDB 10.10: Gene Sequence
pspC gene sequence


Size: 360        A: 75  T: 104  G: 96  C: 85

Fasta

 

>pspC E. coli K12. Version NC_000913.3 GI:556503834
atggcgggcattaatctcaataaaaaattatggcgtattccacagcagggcatggtccgc
ggcgtctgcgccgggattgccaactattttgatgtaccggtaaaactggtgcgtatcctg
gtggtgctgtcgattttcttcggtctggcgctgtttaccctggttgcttacatcattttg
tcatttgcgcttgatccaatgccggacaacatggcctttggtgagcagctaccttccagc
agcgaattgctggatgaagtcgaccgtgaactggcggcaagtgaaacgcgtttacgcgag
atggaacgttatgtcacttccgatactttcacgttacgtagccgtttccgtcaactgtga
              
                            

Download fasta file
RegulonDB