RegulonDB RegulonDB 10.10: Gene Sequence
pssA gene sequence


Size: 1356        A: 350  T: 343  G: 334  C: 329

Fasta

 

>pssA E. coli K12. Version NC_000913.3 GI:556503834
atgttgtcaaaatttaagcgtaataaacatcaacaacaccttgcccaactacccaagatt
tctcaatcagttgatgatgtcgatttcttttacgctcccgccgacttccgggagacgctg
ctggaaaaaatagccagcgcgaagcagcgcatttgcattgtcgccctgtatctcgaacag
gatgacggtggcaaaggcattctgaacgcgttgtatgaggctaaaaggcagcgtccggaa
ctggatgtgcgggtgctggtcgactggcatcgtgcacaacgtggacgcattggcgctgcg
gcatctaacactaacgctgactggtactgccgcatggcgcaggaaaatccgggcgtagat
gttccggtttatggcgttccaatcaatactcgtgaagcccttggtgttctgcactttaaa
ggctttatcatcgacgatagcgtactttatagcggtgccagcctgaacgatgtttacctg
catcagcacgataaatatcgctacgaccgttatcatctgatccgtaaccgtaagatgtca
gacattatgtttgaatgggttacacagaatattatgaatggccgcggcgttaatcgtctg
gatgatgttaatcggccaaaaagcccggaaatcaagaacgatattcgtctgttccgccag
gagctgcgtgatgccgcttatcatttccagggcgatgccgacaacgatcagctttctgta
acgccgctagtggggctggggaaatcgagtctgttgaacaagaccattttccatcttatg
ccttgtgccgagcagaaactaaccatctgtacgccatacttcaacctgccagcaatcctt
gtgcgcaatattatccagttgctgcgcgaagggaaaaaggtcgaaattattgttggtgat
aaaaccgcgaatgacttctacattccggaagatgaacctttcaagataattggcgcattg
ccttatctctatgagatcaatctgcgtcgtttcctgagccgtttgcagtattacgtcaat
actgaccagctagtggttcggttatggaaagatgacgacaacacctatcacctgaaaggg
atgtgggttgatgataagtggatgttgatcaccggtaataacctgaacccgcgcgcctgg
cgtctggatctggaaaacgccattttgatccacgatccgcaacttgagctggcgccacag
cgagagaaagaactggagctgatccgcgagcataccaccatcgttaagcactatcgcgat
ctgcaaagtattgccgattatccggtgaaggttcgtaaactcatccgccgtttgcgccgt
atccgcatcgaccgattaattagccgcatcctgtaa
              
                            

Download fasta file
RegulonDB