RegulonDB RegulonDB 10.9: Gene Sequence
pstC gene sequence


Size: 960        A: 177  T: 258  G: 273  C: 252

Fasta

 

>pstC E. coli K12. Version NC_000913.3 GI:556503834
atggctgcaaccaagcctgcttttaacccaccgggtaaaaagggcgacataattttcagc
gtgctggtaaaactggcggcgctgattgtgctattgatgttgggtggcattattgtctct
ctgatcatctcctcctggccgagcattcagaaatttggtctggctttcctatggaccaaa
gagtgggatgcaccgaacgatatctacggggcgctggtgccgatctacggtacgttggtg
acttcgtttatcgcgctgctgatcgccgtcccggtgagtttcggtatcgccctgttcctg
actgagcttgcgcctggctggctgaaacgcccgctgggtatcgccattgagctgctggca
gccattccaagtatcgtttacggcatgtggggcctgtttatctttgcgccgctgttcgcc
gtttactttcaggagccggtcggcaatatcatgtcgaatatcccgattgttggcgcgctg
ttctctggccccgcatttggtatcggtatcctcgcggcaggcgtgatcctcgccatcatg
attattccgtacattgcggcggtaatgcgtgatgtgttcgaacaaaccccggtgatgatg
aaagagtcggcctacggtattggctgcaccacctgggaagttatctggcgtatcgttctt
ccgttcaccaaaaatggtgttatcggcggcatcatgctggggctgggccgcgcgctcggt
gaaaccatggcggtgacctttatcatcggtaacacctaccagctcgacagcgcctcgctg
tatatgccgggcaacagtatcacctctgcgctggcgaacgaatttgcggaagcggaatcc
ggtctgcacgttgccgcactgatggaactgggcctgatcctgtttgtgattaccttcatc
gtcctcgccgcatcgaagtttatgattatgcgcctggctaagaatgagggggcacgctaa
              
                            

Download fasta file
RegulonDB