RegulonDB RegulonDB 10.9: Gene Sequence
pth gene sequence


Size: 585        A: 145  T: 149  G: 156  C: 135

Fasta

 

>pth E. coli K12. Version NC_000913.3 GI:556503834
gtgacgattaaattgattgtcggcctggcgaaccccggtgctgaatacgccgcaacgcga
cataatgctggtgcctggttcgttgacttactggcagagcgtttgcgcgctccgctgcgc
gaagaggctaaattctttggttatacttcgcgagtcactcttggaggcgaagatgtccgc
ctgttagtcccgactacatttatgaatctcagcggcaaagccgttgcggcgatggccagt
tttttccgcattaatccggacgaaattctggtggcccacgacgaactggatctgcctcct
ggcgtcgccaaatttaaattgggcggtggccatggtggtcacaatggactgaaagacatc
atcagtaaattgggtaataaccctaactttcaccgtttacgcatcggaatcggtcatccg
ggcgataaaaataaagttgtcggttttgtgttaggcaaaccgcctgttagtgaacagaag
ttaattgatgaagccattgacgaagcggcgcgttgtactgaaatgtggtttacagatggc
ttgaccaaagcaacgaaccgattgcacgcctttaaagcgcaataa
              
                            

Download fasta file
RegulonDB