RegulonDB RegulonDB 10.9: Gene Sequence
ptsG gene sequence


Size: 1434        A: 287  T: 392  G: 382  C: 373

Fasta

 

>ptsG E. coli K12. Version NC_000913.3 GI:556503834
atgtttaagaatgcatttgctaacctgcaaaaggtcggtaaatcgctgatgctgccggta
tccgtactgcctatcgcaggtattctgctgggcgtcggttccgcgaatttcagctggctg
cccgccgttgtatcgcatgttatggcagaagcaggcggttccgtctttgcaaacatgcca
ctgatttttgcgatcggtgtcgccctcggctttaccaataacgatggcgtatccgcgctg
gccgcagttgttgcctatggcatcatggttaaaaccatggccgtggttgcgccactggta
ctgcatttacctgctgaagaaatcgcctctaaacacctggcggatactggcgtactcgga
gggattatctccggtgcgatcgcagcgtacatgtttaaccgtttctaccgtattaagctg
cctgagtatcttggcttctttgccggtaaacgctttgtgccgatcatttctggcctggct
gccatctttactggcgttgtgctgtccttcatttggccgccgattggttctgcaatccag
accttctctcagtgggctgcttaccagaacccggtagttgcgtttggcatttacggtttc
atcgaacgttgcctggtaccgtttggtctgcaccacatctggaacgtacctttccagatg
cagattggtgaatacaccaacgcagcaggtcaggttttccacggcgacattccgcgttat
atggcgggtgacccgactgcgggtaaactgtctggtggcttcctgttcaaaatgtacggt
ctgccagctgccgcaattgctatctggcactctgctaaaccagaaaaccgcgcgaaagtg
ggcggtattatgatctccgcggcgctgacctcgttcctgaccggtatcaccgagccgatc
gagttctccttcatgttcgttgcgccgatcctgtacatcatccacgcgattctggcaggc
ctggcattcccaatctgtattcttctggggatgcgtgacggtacgtcgttctcgcacggt
ctgatcgacttcatcgttctgtctggtaacagcagcaaactgtggctgttcccgatcgtc
ggtatcggttatgcgattgtttactacaccatcttccgcgtgctgattaaagcactggat
ctgaaaacgccgggtcgtgaagacgcgactgaagatgcaaaagcgacaggtaccagcgaa
atggcaccggctctggttgctgcatttggtggtaaagaaaacattactaacctcgacgca
tgtattacccgtctgcgcgtcagcgttgctgatgtgtctaaagtggatcaggccggcctg
aagaaactgggcgcagcgggcgtagtggttgctggttctggtgttcaggcgattttcggt
actaaatccgataacctgaaaaccgagatggatgagtacatccgtaaccactaa
              
                            

Download fasta file
RegulonDB