RegulonDB RegulonDB 10.8: Gene Sequence
ptsI gene sequence


Size: 1728        A: 460  T: 410  G: 459  C: 399

Fasta

 

>ptsI E. coli K12. Version NC_000913.3 GI:556503834
atgatttcaggcattttagcatccccgggtatcgctttcggtaaagctctgcttctgaaa
gaagacgaaattgtcattgaccggaaaaaaatttctgccgaccaggttgatcaggaagtt
gaacgttttctgagcggtcgtgccaaggcatcagcccagctggaaacgatcaaaacgaaa
gctggtgaaacgttcggtgaagaaaaagaagccatctttgaagggcatattatgctgctc
gaagatgaggagctggagcaggaaatcatagccctgattaaagataagcacatgacagct
gacgcagctgctcatgaagttatcgaaggtcaggcttctgccctggaagagctggatgat
gaatacctgaaagaacgtgcggctgacgtacgtgatatcggtaagcgcctgctgcgcaac
atcctgggcctgaagattatcgacctgagcgccattcaggatgaagtcattctggttgcc
gctgacctgacgccgtccgaaaccgcacagctgaacctgaagaaggtgctgggtttcatc
accgacgcgggtggccgtacttcccacacctctatcatggcgcgttctctggaactacct
gctatcgtgggtaccggtagcgtcacctctcaggtgaaaaatgacgactatctgattctg
gatgccgtaaataatcaggtttacgtcaatccaaccaacgaagttattgataaaatgcgc
gctgttcaggagcaagtggcttctgaaaaagcagagcttgctaaactgaaagatctgcca
gctattacgctggacggtcaccaggtagaagtatgcgctaacattggtacggttcgtgac
gttgaaggtgcagagcgtaacggcgctgaaggcgttggtctgtatcgtactgagttcctg
ttcatggaccgcgacgcactgcccactgaagaagaacagtttgctgcttacaaagcagtg
gctgaagcgtgtggctcgcaagcggttatcgttcgtaccatggacatcggcggcgacaaa
gagctgccatacatgaacttcccgaaagaagagaacccgttcctcggctggcgcgctatc
cgtatcgcgatggatcgtagagagatcctgcgcgatcagctccgcgctatcctgcgtgcc
tcggctttcggtaaattgcgcattatgttcccgatgatcatctctgttgaagaagtgcgt
gcactgcgcaaagagatcgaaatctacaaacaggaactgcgcgacgaaggtaaagcgttt
gacgagtcaattgaaatcggcgtaatggtggaaacaccggctgccgcaacaattgcacgt
catttagccaaagaagttgatttctttagtatcggcaccaatgatttaacgcagtacact
ctggcagttgaccgtggtaatgatatgatttcacacctttaccagccaatgtcaccgtcc
gtgctgaacttgatcaagcaagttattgatgcttctcatgctgaaggcaaatggactggc
atgtgtggtgagcttgctggcgatgaacgtgctacacttctgttgctggggatgggtctg
gacgaattctctatgagcgccatttctatcccgcgcattaagaagattatccgtaacacg
aacttcgaagatgcgaaggtgttagcagagcaggctcttgctcaaccgacaacggacgag
ttaatgacgctggttaacaagttcattgaagaaaaaacaatctgctaa
              
                            

Download fasta file
RegulonDB