RegulonDB RegulonDB 10.9: Gene Sequence
purC gene sequence


Size: 714        A: 185  T: 156  G: 210  C: 163

Fasta

 

>purC E. coli K12. Version NC_000913.3 GI:556503834
atgcaaaagcaagctgagttgtatcgtggtaaagcgaaaaccgtatacagcacggaaaac
ccggacctgttggtgctcgaattccgcaatgatacgtcagcaggggatggcgcgcgcatt
gagcagtttgatcgcaaaggtatggtgaacaacaagttcaactacttcattatgagcaaa
ctggctgaagcgggtatcccgactcaaatggagcgtctgctctccgataccgaatgtctg
gtgaaaaagctggatatggtgccggttgagtgtgtcgtgcgtaaccgtgctgctggctct
ctggtgaaacgtcttggaatcgaagaaggtattgagctgaacccgccgctgttcgatctg
ttcctgaaaaacgacgccatgcacgatccgatggtcaacgaatcttactgcgaaaccttt
ggctgggtgagcaaagagaacctggcgcgtatgaaagagctgacctacaaagcgaacgac
gtgctgaaaaaactgttcgatgatgctggtctgattctggtcgacttcaagctggaattt
ggtctgtacaaaggcgaagtggtactgggtgatgagttctccccggacggtagccgcctg
tgggacaaagaaacgctggagaaaatggacaaagaccgtttccgccagagcctcggtggc
ctgatcgaagcctatgaagccgtcgcccgccgcctgggtgtacagctggactga
              
                            

Download fasta file
RegulonDB