RegulonDB RegulonDB 10.9: Gene Sequence
purE gene sequence


Size: 510        A: 114  T: 95  G: 152  C: 149

Fasta

 

>purE E. coli K12. Version NC_000913.3 GI:556503834
atgtcttcccgcaataatccggcgcgtgtcgccatcgtgatggggtccaaaagcgactgg
gctaccatgcagttcgccgccgaaatcttcgaaatcctgaatgtcccgcaccacgttgaa
gtggtttctgctcaccgcacccccgataaactgttcagcttcgccgaaagcgccgaagag
aacggttatcaggtgattattgcgggcgcaggcggcgcagcgcatctgccaggcatgatt
gccgccaaaacgctggtgccggtgctgggcgtgccagtacagagcgccgcactgagcggt
gtcgatagcctctactccatcgtacaaatgccgcgcggcattccggtgggtacgctggcg
attggtaaagctggcgcggcaaacgcggcgttactggcagcacaaattcttgcgactcat
gataaagaactgcaccagcgtctgaatgactggcgcaaagcccagaccgacgaagtgctg
gaaaacccggacccgcgaggtgcggcatga
              
                            

Download fasta file
RegulonDB