RegulonDB RegulonDB 10.9: Gene Sequence
purF gene sequence


Size: 1518        A: 356  T: 359  G: 401  C: 402

Fasta

 

>purF E. coli K12. Version NC_000913.3 GI:556503834
atgtgcggtattgtcggtatcgccggtgttatgccggttaaccagtcgatttatgatgcc
ttaacggtgcttcagcatcgcggtcaggatgccgccggcatcatcaccatagatgccaat
aactgcttccgtttgcgtaaagcgaacgggctggtgagcgatgtatttgaagctcgccat
atgcagcgtttgcagggcaatatgggcattggtcatgtgcgttaccccacggctggcagc
tccagcgcctctgaagcgcagccgttttacgttaactccccgtatggcattacgcttgcc
cacaacggcaatctgaccaacgctcacgagttgcgtaaaaaactgtttgaagaaaaacgc
cgccacatcaacaccacttccgactcggaaattctgcttaatatcttcgccagcgagctg
gacaacttccgccactacccgctggaagccgacaatattttcgctgccattgctgccaca
aaccgcttaatccgcggcgcgtatgcctgtgtggcgatgattatcggccacggtatggtt
gctttccgcgatccaaacgggattcgtccgctggtactgggaaaacgtgatattgacgag
aaccgtacagaatatatggtcgcttccgaaagcgtagcgctcgatacgctgggctttgat
ttcctgcgtgacgtcgcgccgggcgaagcgatttacatcactgaagaagggcagttgttt
acccgtcaatgtgctgacaatccggtcagcaatccgtgcctgtttgagtatgtatacttt
gcccgcccggactcgtttatcgacaaaatttccgtttacagcgcgcgtgtgaatatgggc
acgaaactgggcgagaaaattgcccgcgaatgggaagatctggatatcgacgtggtgatc
ccgatcccagaaacctcgtgtgatatcgcgctggaaattgctcgtattctgggcaaaccg
taccgccagggcttcgttaaaaaccgctatgttggccgcacctttatcatgccgggccag
cagctgcgtcgtaagtccgtgcgccgtaaactgaatgccaaccgcgccgagttccgcgat
aaaaacgtcctgctggtcgacgactccatcgtccgtggcaccacttctgagcagattatc
gagatggcacgcgaagccggagcgaagaaagtgtacctcgcttctgcggcaccggaaatt
cgcttcccgaacgtttatggtattgatatgccgagcgccacggaactgatcgctcacggt
cgcgaagttgatgaaattcgccagatcatcggtgctgacgggttgattttccaggatctg
aacgatctgatcgacgccgttcgcgctgaaaatccggatatccagcagtttgaatgctcg
gtgttcaacggcgtctacgtcaccaaagatgttgatcagggctacctcgatttcctcgat
acgttacgtaatgatgacgccaaagcagtgcaacgtcagaacgaagtggaaaatctcgaa
atgcataacgaaggatga
              
                            

Download fasta file
RegulonDB