RegulonDB RegulonDB 10.9: Gene Sequence
purH gene sequence


Size: 1590        A: 363  T: 332  G: 450  C: 445

Fasta

 

>purH E. coli K12. Version NC_000913.3 GI:556503834
atgcaacaacgtcgtccagtccgccgcgctctgctcagtgtttctgacaaagccggtatc
gtcgaattcgcccaggcactttccgcacgcggtgtggagctgctgtctacagggggcact
gcccgtctgttagcagaaaaaggtctgccggtaaccgaagtttccgattacaccggtttc
ccggagatgatggatggacgcgtgaagaccctgcatccgaaagtacatggtggcattctg
ggccgtcgcggccaggacgatgccattatggaagaacatcagatccagcctatcgatatg
gtggttgttaacctgtatccgttcgcccagaccgtggcccgtgaaggttgctcgctggaa
gatgcggttgagaacatcgatatcggcggcccaacgatggtgcgctccgccgccaagaac
cataaagatgtcgcaatcgtggtgaagagcagcgactatgacgccattattaaagagatg
gatgacaacgaaggatcgctgacgcttgcaacccgtttcgacctcgccatcaaagccttc
gaacacactgccgcctacgacagcatgattgccaactacttcggcagcatggttccggct
taccacggtgaaagcaaagaagccgccggtcgcttcccacgcacgctgaacctgaacttc
attaagaagctggatatgcgttacggcgagaacagccaccagcaggctgccttctatata
gaagagaatgtgaaagaagcctccgttgctaccgcaacccaggttcagggtaaagccctc
tcttataacaacatcgccgataccgatgcggcgctggagtgcgtgaaagagttcgccgag
ccggcatgtgtgattgtgaagcacgccaacccttgcggcgtggctatcggcaattccatt
cttgatgcttacgatcgcgcgtacaaaaccgacccaacctccgcattcggcggcatcatt
gcctttaaccgcgagctggatgcggaaaccgcacaggccatcatttctcgtcagtttgtc
gaagtgattattgcgccgtccgccagcgaagaagccctgaaaatcaccgccgccaaacag
aacgtacgcgttctgacctgcggtcagtggggcgagcgtgttccgggcctcgatttcaaa
cgcgtgaacggcggtctgctggttcaggatcgtgacctggggatggtcggtgcggaagaa
ctgcgcgtggtgaccaaacgtcagccgagcgaacaggaactgcgtgatgcgctgttctgc
tggaaggtggcgaagtttgtgaaatccaacgctatcgtctatgccaaaaacaatatgact
atcggcattggcgcgggccagatgagccgcgtgtactccgcaaaaatcgccggtattaaa
gcggccgatgaaggcctggaagtgaaaggttcctcgatggcttctgacgcgttcttcccg
ttccgcgacggtattgatgccgccgccgctgcgggcgtgacctgcgtaatccagcctggc
ggttctatccgtgatgacgaagtgattgccgccgccgacgagcacggtattgcgatgctc
ttcaccgacatgcgccacttccgccattaa
              
                            

Download fasta file
RegulonDB