RegulonDB RegulonDB 10.9: Gene Sequence
purL gene sequence


Size: 3888        A: 838  T: 838  G: 1165  C: 1047

Fasta

 

>purL E. coli K12. Version NC_000913.3 GI:556503834
atgatggaaattctgcgtggttcgcctgcactgtcggcattccgaatcaacaaactgctg
gcacgttttcaggctgccaggctcccggttcacaatatttacgccgagtatgtccatttt
gctgacctcaatgcgccgttaaacgatgatgagcacgcacaacttgaacgcctgctgaaa
tatggcccggcactcgccagccacgccccgcaaggcaaactcctgctggtgaccccgcgt
cctggcaccatctctccctggtcttcgaaagcgaccgatattgcccataactgcgggcta
caacaggtaaaccgccttgagcgcggcgttgcttactatatagaagccggtacgctgacc
aatgaacaatggcagcaggttaccgctgaactgcacgaccgcatgatggaaacggtcttt
tttgctttagatgatgcagagcagttgtttgcccaccatcaaccgactccggttaccagc
gttgatttgctggggcagggccgtcaggcgctgatcgacgctaacctgcgtcttggcttg
gctctggcggaagatgaaattgactatctgcaggatgctttcacaaagcttggtcgtaac
ccgaacgacatcgaactgtatatgtttgcccaggcgaactccgagcactgccgccacaaa
atttttaacgccgactgggttatcgatggtgaacagcagccgaaatcgctgttcaagatg
atcaaaaatactttcgaaaccacgccagatcacgttctctctgcttataaagataacgcc
gccgtaatggaaggttctgaagtgggccgctactttgctgaccacgaaacgggccgctac
gatttccatcaggaaccggcgcatattctgatgaaagtcgaaactcacaaccacccgacg
gcgatttctccgtggccgggcgcggcgaccggttccggcggtgaaatccgcgatgaaggt
gccaccgggcgcggcgcaaagccgaaagcgggtctggttggtttctccgtttccaacctg
cgaattcctggcttcgaacagccgtgggaagaagatttcggtaagcctgagcgcattgtc
accgcgctggacatcatgaccgaaggcccgctgggcggcgcggcgtttaacaacgaattt
ggtcgtccggcactgaacggctacttccgtacttatgaagaaaaagtgaacagccacaac
ggcgaagagctgcgcggttatcacaaaccgatcatgctggcgggcgggatcggcaacatt
cgcgccgatcacgtacaaaaaggcgagatcaacgtcggtgcgaagctggtcgttctcggc
ggcccggcaatgaacatcggtcttggcggtggtgcagcgtcttctatggcgtctggtcag
tctgatgccgacctcgactttgcttccgtacagcgcgacaacccggagatggagcgtcgc
tgccaggaagtgatcgaccgttgctggcagcttggtgatgccaacccaatcctgtttatc
cacgacgttggcgctggcggtctttctaacgccatgccggaactggtgagcgacggcggg
cgcggcggtaaatttgaactgcgcgagattctaagcgacgaaccgggcatgagcccgctg
gaaatctggtgtaacgaatcccaggaacgctacgtgctggcggttgctgccgatcaatta
ccgctgtttgacgaactgtgtaagcgtgagcgcgcaccctacgcggtgattggtgaagcg
accgaagaactgcatctttctctgcacgatcgtcattttgataatcagccgatcgatctg
ccgctggacgtcctgcttggtaaaacgccgaagatgacccgcgatgtacaaacgctgaaa
gcgaaaggcgacgcgctggcccgtgaagggatcaccattgcagacgcggtgaaacgtgtg
ctgcatctgccgactgtggcggaaaaaaccttcctggtgaccattggcgaccgcagcgta
accggcatggtagcgcgcgatcagatggtggggccgtggcaggtgccggtcgctaactgc
gcggtcactaccgccagcctcgacagctactacggtgaagcgatggcgattggcgagcgt
gcgccggttgcgctgctggatttcgccgcctctgcccgtctggcggtcggtgaagcgtta
accaacatcgccgcaacacaaattggcgatatcaaacgcatcaaactttccgccaactgg
atggcggcggcaggccaccctggtgaagatgcgggcctgtatgaagccgttaaagccgtg
ggcgaagagctttgtccggcgctgggcctgacgatcccggtgggtaaagactccatgtcg
atgaaaacccgctggcaggaaggtaacgaagagcgcgaaatgacgtcgccgctgtcgctg
gtgatttctgcatttgcccgcgtggaagatgtacgtcacaccatcacgccgcagctttct
accgaagataacgcactgctgctgattgatttgggcaaaggcaataacgcgctgggcgca
acggcgctggcgcaggtttatcgtcagcttggcgacaaaccggcagatgtacgcgatgtc
gcgcaactgaaaggcttctatgacgcgattcaggcgctggttgcacagcgtaagctgctg
gcgtatcacgaccgctctgatggcggcctgctggtaacgctggcggaaatggcctttgct
ggtcattgtggcattgacgcggatatcgccactctgggtgacgatcgcctggcggcgttg
tttaacgaagaactgggtgcggtgattcaggttcgtgccgctgaccgtgaagcggtcgag
tccgtactggcacagcatgggcttgctgattgtgtccattatgtagggcaggcggtttcc
ggtgaccgttttgtgattaccgccaacgggcagactgtattcagcgaaagccgcaccacg
ttgcgtgtctggtgggcagaaactacctggcagatgcagcgcctgcgtgacaacccggag
tgtgccgatcaggagcatcaggcgaaatctaacgacgccgatccgggcctgaatgtaaaa
ctgtcgttcgatatcaacgaagatgtggcagcaccgtatattgccactggcgcacgtccg
aaagttgccgtactgcgtgagcagggcgtgaactcgcatgttgaaatggcggcagctttc
caccgtgcaggctttgatgctatcgacgtgcatatgagtgacctgctgaccggacgcacg
ggcctggaagatttccacgccctggtcgcgtgcggtggtttctcctacggtgatgtgctg
ggtgccggtgaaggttgggcgaagtcaatcctgttcaatgaccgtgtacgcgatgagttt
gcaaccttcttccaccgtccgcaaacgctggcgctgggggtatgtaacggttgccagatg
atgtctaatctgcgtgaactgatcccaggtagtgagttgtggccacgttttgtgcgcaat
acctccgatcgctttgaagcgcgtttcagcctggttgaagtaacccaaagcccgtctctg
ctgttgcaggggatggtgggctcgcaaatgccgattgctgtctctcatggtgaagggcgc
gtggaagtgcgtgatgcggcgcatctggcggcactggaaagcaaagggctggtggcactg
cgctatgtcgataacttcggcaaagtcactgaaacctacccggctaacccgaacggttca
ccgaacggtattacggcagtcacgactgaaagtggtcgagtcaccattatgatgccgcac
ccggaacgtgttttccgtactgtcagcaactcctggcatccggaaaactggggcgaggat
ggcccatggatgcgcattttccgcaatgcgcgtaagcagttggggtaa
              
                            

Download fasta file
RegulonDB