RegulonDB RegulonDB 10.9: Gene Sequence
purM gene sequence


Size: 1038        A: 245  T: 244  G: 305  C: 244

Fasta

 

>purM E. coli K12. Version NC_000913.3 GI:556503834
gtgaccgataaaacctctcttagctacaaagatgccggtgttgatattgacgcgggtaat
gctctggttggaagaatcaaaggcgtagtgaagaaaacgcgtcgtccggaagtgatgggc
ggtctgggcggcttcggtgcgctgtgtgcattgccgcaaaaatatcgtgaacccgtgctg
gtttctggcactgacggcgtaggtaccaagctgcgtctggcaatggacttaaaacgtcac
gacaccattggtattgatctggtcgccatgtgcgttaatgacctggtggtgcaaggtgca
gagccgctgtttttcctcgactattacgcaaccggaaaactggatgttgataccgcttca
gcggtgatcagcggcattgcggaaggttgtctgcaatcaggctgttcactggtgggtggc
gaaacggcagaaatgccggggatgtatcacggtgaggattacgatgtcgcgggtttctgc
gttggcgtggtagaaaaatcagaaatcatcgacggctctaaagtcagcgacggcgatgtg
ctgattgcactcggttccagcggtccacactcgaacggctattcgctggtgcgcaaaatt
cttgaagtcagcggttgtgatccgcaaaccaccgaacttgatggtaagccattagccgat
catctgctggcaccgacccgcatttacgtgaagtcagtgctggagttgattgaaaaggtc
gatgtgcatgccattgcgcacctgaccggcggcggcttctgggaaaacattccgcgcgta
ttgccagataatactcaggcagtgattgatgaatcttcctggcagtggccggaagtgttc
aactggctgcaaacggcaggtaacgttgagcaccatgaaatgtatcgcaccttcaactgc
ggcgtcgggatgattattgccctgcctgctccggaagtggacaaagccctcgccctgctc
aatgccaacggtgaaaacgcgtggaaaatcggtatcatcaaagcctctgattccgaacaa
cgcgtggttatcgaataa
              
                            

Download fasta file
RegulonDB