RegulonDB RegulonDB 10.9: Gene Sequence
purN gene sequence


Size: 639        A: 147  T: 149  G: 174  C: 169

Fasta

 

>purN E. coli K12. Version NC_000913.3 GI:556503834
atgaatattgtggtgcttatttccggcaacggaagtaatttacaggcaattattgacgcc
tgtaaaaccaacaaaattaaaggcaccgtacgggcagttttcagcaataaggccgacgcg
ttcggccttgaacgcgcccgccaggcgggtattgcaacgcatacgctcatcgccagcgcg
tttgacagtcgtgaagcctatgaccgggagttgattcatgaaatcgacatgtacgcaccc
gatgtggtcgtgctggctggttttatgcgcattctcagcccggcgtttgtctcccactat
gccgggcgtttgctgaacattcacccttctctgctgccgaaatatcccggattacacacc
catcgtcaggcgctggaaaatggcgatgaagagcacggtacatcggtgcatttcgtcacc
gatgaactggacggtggcccggttattttacaggcgaaagtcccggtatttgctggtgat
tcggaagatgacatcaccgcccgcgtgcaaacccaggaacacgccatttatccactggtg
attagctggtttgccgatggtcgtctgaaaatgcacgaaaacgccgcgtggctggatggt
caacgtctgccgccgcagggctacgctgccgacgagtaa
              
                            

Download fasta file
RegulonDB