RegulonDB RegulonDB 10.9: Gene Sequence
pykA gene sequence


Size: 1443        A: 355  T: 326  G: 402  C: 360

Fasta

 

>pykA E. coli K12. Version NC_000913.3 GI:556503834
atgtccagaaggcttcgcagaacaaaaatcgttaccacgttaggcccagcaacagatcgc
gataataatcttgaaaaagttatcgcggcgggtgccaacgttgtacgtatgaacttttct
cacggctcgcctgaagatcacaaaatgcgcgcggataaagttcgtgagattgccgcaaaa
ctggggcgtcatgtggctattctgggtgacctccaggggcccaaaatccgtgtatccacc
tttaaagaaggcaaagttttcctcaatattggggataaattcctgctcgacgccaacctg
ggtaaaggtgaaggcgacaaagaaaaagtcggtatcgactacaaaggcctgcctgctgac
gtcgtgcctggtgacatcctgctgctggacgatggtcgcgtccagttaaaagtactggaa
gttcagggcatgaaagtgttcaccgaagtcaccgtcggtggtcccctctccaacaataaa
ggtatcaacaaacttggcggcggtttgtcggctgaagcgctgaccgaaaaagacaaagca
gacattaagactgcggcgttgattggcgtagattacctggctgtctccttcccacgctgt
ggcgaagatctgaactatgcccgtcgcctggcacgcgatgcaggatgtgatgcgaaaatt
gttgccaaggttgaacgtgcggaagccgtttgcagccaggatgcaatggatgacatcatc
ctcgcctctgacgtggtaatggttgcacgtggcgacctcggtgtggaaattggcgacccg
gaactggtcggcattcagaaagcgttgatccgtcgtgcgcgtcagctaaaccgagcggta
atcacggcgacccagatgatggagtcaatgattactaacccgatgccgacgcgtgcagaa
gtcatggacgtagcaaacgccgttctggatggtactgacgctgtgatgctgtctgcagaa
actgccgctgggcagtatccgtcagaaaccgttgcagccatggcgcgcgtttgcctgggt
gcggaaaaaatcccgagcatcaacgtttctaaacaccgtctggacgttcagttcgacaat
gtggaagaagctattgccatgtcagcaatgtacgcagctaaccacctgaaaggcgttacg
gcgatcatcaccatgaccgaatcgggtcgtaccgcgctgatgacctcccgtatcagctct
ggtctgccaattttcgccatgtcgcgccatgaacgtacgctgaacctgactgctctctat
cgtggcgttacgccggtgcactttgatagcgctaatgacggcgtagcagctgccagcgaa
gcggttaatctgctgcgcgataaaggttacttgatgtctggtgacctggtgattgtcacc
cagggcgacgtgatgagtaccgtgggttctactaataccacgcgtattttaacggtagag
taa
              
                            

Download fasta file
RegulonDB