RegulonDB RegulonDB 11.0: Gene Sequence
pykF gene sequence


Size: 1413        A: 385  T: 323  G: 354  C: 351

Fasta

 

>pykF E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaagaccaaaattgtttgcaccatcggaccgaaaaccgaatctgaagagatgtta
gctaaaatgctggacgctggcatgaacgttatgcgtctgaacttctctcatggtgactat
gcagaacacggtcagcgcattcagaatctgcgcaacgtgatgagcaaaactggtaaaacc
gccgctatcctgcttgataccaaaggtccggaaatccgcaccatgaaactggaaggcggt
aacgacgtttctctgaaagctggtcagacctttactttcaccactgataaatctgttatc
ggcaacagcgaaatggttgcggtaacgtatgaaggtttcactactgacctgtctgttggc
aacaccgtactggttgacgatggtctgatcggtatggaagttaccgccattgaaggtaac
aaagttatctgtaaagtgctgaacaacggtgacctgggcgaaaacaaaggtgtgaacctg
cctggcgtttccattgctctgccagcactggctgaaaaagacaaacaggacctgatcttt
ggttgcgaacaaggcgtagactttgttgctgcttcctttattcgtaagcgttctgacgtt
atcgaaatccgtgagcacctgaaagcgcacggcggcgaaaacatccacatcatctccaaa
atcgaaaaccaggaaggcctcaacaacttcgacgaaatcctcgaagcctctgacggcatc
atggttgcgcgtggcgacctgggtgtagaaatcccggtagaagaagttatcttcgcccag
aagatgatgatcgaaaaatgtatccgtgcacgtaaagtcgttatcactgcgacccagatg
ctggattccatgatcaaaaacccacgcccgactcgcgcagaagccggtgacgttgcaaac
gccatcctcgacggtactgacgcagtgatgctgtctggtgaatccgcaaaaggtaaatac
ccgctggaagcggtttctatcatggcgaccatctgcgaacgtaccgaccgcgtgatgaac
agccgtctcgagttcaacaatgacaaccgtaaactgcgcattaccgaagcggtatgccgt
ggtgccgttgaaactgctgaaaaactggatgctccgctgatcgtggttgctactcagggc
ggtaaatctgctcgcgcagtacgtaaatacttcccggatgccaccatcctggcactgacc
accaacgaaaaaacggctcatcagttggtactgagcaaaggcgttgtgccgcagcttgtt
aaagagatcacttctactgatgatttctaccgtctgggtaaagaactggctctgcagagc
ggtctggcacacaaaggtgacgttgtagttatggtttctggtgcactggtaccgagcggc
actactaacaccgcatctgttcacgtcctgtaa
              
                            

Download fasta file
RegulonDB