RegulonDB RegulonDB 10.9: Gene Sequence
recB gene sequence


Size: 3543        A: 811  T: 799  G: 1018  C: 915

Fasta

 

>recB E. coli K12. Version NC_000913.3 GI:556503834
atgagtgatgtcgccgagacactagatcctttgcgcttgcccttacagggtgagcgcctg
attgaagcctctgccggcacaggcaaaacctttacgattgcggcgctctatttgcgcctg
ttacttggactaggcggttccgccgcctttccccgcccgctgaccgttgaagaactgctg
gtggtcacctttaccgaggctgccacggcagaattgcgcggtcgtatccgtagcaatatc
cacgagttgcgcatcgcctgtctgcgtgaaaccaccgacaatccactgtacgaacgcctg
ctggaagagatcgacgataaagcgcaagccgcgcagtggttgttgttagccgaacggcag
atggatgaagcggcagtctttactattcacggcttttgccagcgcatgctcaacctgaat
gcctttgaatccggcatgctgtttgagcagcagctgattgaagatgagtctctgctacgc
taccaggcctgcgccgatttctggcgtcgccactgctacccgctgccgcgtgaaatagcc
caggtcgtctttgaaacctggaaagggccgcaggcgttgctgcgcgatattaatcgttat
ctgcaaggcgaagcgccggttatcaaagcaccgccgcccgatgatgaaacgctggcttcc
cgtcacgcgcaaattgtggcgcgtattgatacggtaaaacagcagtggcgcgacgcagtg
ggtgaactggatgcgctgatcgaatcttctggtattgatcgacgcaagtttaaccgtagc
aatcaggctaaatggatcgacaagatcagcgcctgggcagaagaagagacaaacagttat
cagttgccggagtcgctggaaaaattctcccagcgtttcttagaagatcgcacgaaggcc
gggggggaaaccccgcgacatccactgtttgaggcgatcgatcaactgcttgcagaacca
ttgtcgatccgcgatctggtgatcacccgcgcattggctgagatccgcgaaacagtagcg
cgtgaaaaacgccgccgtggcgaattgggttttgatgacatgttaagtcggctcgattcc
gcgctgcgtagcgaaagcggtgaggtgttggcagcggcgatccgtacgcgattcccggtg
gcaatgatcgatgaatttcaggataccgacccccagcagtaccgaatttttcgccgtatc
tggcaccatcagccggaaaccgcattgttgctaattggcgacccgaagcaggccatatat
gcattccggggtgcggatatcttcacttatatgaaggcgcgtagcgaagttcacgcccac
tacactttagacaccaactggcgttccgcaccaggaatggtgaacagcgtgaataagctt
ttcagccagactgatgacgcgttcatgtttcgcgaaataccgtttattccagtgaaatca
gccgggaaaaatcaggcgttacgttttgtatttaaaggtgaaacacagcctgcgatgaaa
atgtggctgatggaaggcgaaagctgcggcgttggcgattatcaaagtaccatggcgcag
gtatgtgctgcgcaaatccgcgactggctacaagccggacagcggggcgaagcgttgctg
atgaacggcgacgacgcgcgtccggtgcgtgcttcggacatcagtgtgctggtgcgcagc
cgccaggaggccgcccaggtgcgcgatgccttaacgttgctggaaatcccttccgtttac
ctttcgaaccgcgacagtgtttttgaaactctggaagcgcaggaaatgctttggttgttg
caggcggtgatgacgcccgaacgtgagaacaccctgcgtagtgcgctggcaacgtcaatg
atggggctgaacgcgctggatatcgaaacgctgaacaatgacgaacatgcgtgggatgtg
gtagtcgaagagttcgatggttatcggcaaatctggcgcaaacgtggcgttatgccgatg
ctgcgggcgctgatgtcggcgcgtaacattgctgaaaacttgctggcaacggcaggcggt
gagcggcgtcttaccgatatcttgcatatcagcgaactgctacaagaagccggaacgcag
ctggaaagtgaacatgcgctggtacgctggttatcgcaacatatcctcgagccagacagt
aatgcctccagccaacaaatgcgtctcgaaagtgataaacatctggtgcagattgtcacg
atccacaaatcgaaagggctggaatatccattggtctggctgccgtttatcaccaatttc
cgcgtccaggagcaggcgttttatcacgatcgccactcgtttgaggcagttctggatctt
aatgctgcgccagaaagcgtcgacctcgcggaggccgaacgtctggcggaagatctgcgt
ttgctttacgtggcgctgacacgttcggtttggcattgcagtctcggcgttgcaccgctg
gtgcgccgtcgtggcgataaaaaaggtgacaccgacgtccaccaaagtgcgctcgggcgt
ttgctgcaaaaaggggaaccgcaagatgcggcagggcttcgcacctgtattgaagcgtta
tgcgatgatgatattgcctggcaaacggcacaaactggtgataaccaaccctggcaggtt
aatgatgtttctacagcagagctgaatgcgaagacgttacaacgattgcccggcgataac
tggcgcgtcaccagctactctggtttgcaacagcgtggtcacggtatcgcccaggatttg
atgcctcggctggatgtcgatgctgcaggcgttgccagcgtcgttgaagaaccgacgtta
acaccacatcagtttccgcgcggtgcgtcaccggggacgttcttgcacagtttgtttgaa
gacctggattttacccagccggttgacccgaactgggtgcgggaaaaactggaactcggc
ggctttgaatcgcagtgggaaccggtattgaccgagtggatcacggctgtcctccaggca
cctctcaatgaaaccggcgtaagcctgagtcaactttccgcccgcaataaacaggtggag
atggagttttatctgccgattagtgaaccgcttatcgccagtcagcttgatacgttaatc
cgccagtttgacccgctatccgcaggctgcccgccgctggagttcatgcaggtacgtggc
atgttaaaaggctttatcgacctggtgttccgccacgaagggcgttattacctgctcgac
tataaatccaactggttgggtgaagacagttcggcttacacccaacaggctatggcagcg
gcaatgcaggcacaccgctatgatctgcaatatcagctttataccctggcgctgcatcgt
tatctgcgccatcgcattgctgattacgactatgagcaccactttggcggcgttatttat
ctgttcctgcgtggcgttgataaagaacatccgcaacaggggatttacacaacccgaccc
aacgccgggttgattgccctgatggatgagatgtttgccggtatgaccctggaggaggcg
taa
              
                            

Download fasta file
RegulonDB