RegulonDB RegulonDB 10.9: Gene Sequence
recC gene sequence


Size: 3369        A: 753  T: 810  G: 947  C: 859

Fasta

 

>recC E. coli K12. Version NC_000913.3 GI:556503834
atgttaagggtctaccattccaatcgtctggacgtgctggaagcgttgatggagtttatt
gtcgaacgcgaacggctggacgatcctttcgaaccagagatgattctggtgcaaagtacc
ggtatggcacagtggctgcaaatgaccctgtcgcaaaagtttggtattgcggcaaacatt
gattttccgctgccagcgagctttatctgggatatgttcgtccgggtgttaccggaaatc
cccaaagagagcgcctttaacaaacagagcatgagctggaaactgatgactctgctgccg
caattgctggagcgcgaagactttaccctgttgcggcattatctgactgacgatagcgac
aagcgaaaactgttccagctttcctcaaaagcggcggacctgtttgaccagtatctggtc
tatcgtccggactggctggcacagtgggaaacaggacatttggttgaagggctgggagaa
gcacaggcctggcaagccccgttgtggaaggcgctggtggaatatacccatcaactcggg
caaccgcgctggcaccgcgccaatctctatcagcgctttatcgaaacgctggagtccgcg
acgacctgcccgccggggttaccttcgcgcgtctttatatgcggtatttccgcgttaccg
cctgtttatctccaggcgctacaggcgctgggtaaacatattgaaatccatctcctgttt
accaacccctgccgttattactggggcgatattaaagatcctgcttatctggcgaaactg
ctgacccgtcagcgtcgacacagttttgaagatcgcgaattgccgctatttcgtgatagc
gaaaatgccgggcagctctttaacagcgatggtgaacaggatgtcggcaacccgctgctg
gcttcatggggtaagcttgggcgcgactacatttatctcctttctgacctggagagcagc
caggagctggacgcctttgtcgatgtcacgccagataacctgctgcataacattcagtct
gacattctggaactggaaaaccgcgccgttgctggtgtgaacatcgaagagttttcccgt
agcgataacaaacgcccgcttgatccactggatagcagtatcaccttccacgtttgccat
agcccgcagcgtgaagttgaagttttacacgatcgcctgctggcgatgctggaggaagac
ccgacacttactccgcgcgacatcatcgtgatggtggctgatatcgacagctacagtccg
tttattcaggctgtgtttggtagcgcacctgcggatcgttacctaccttacgccatttcc
gaccgtcgtgcgcggcagtcacatccggtactggaagcgtttatcagcctgttatcactg
cctgacagtcgttttgtgtcagaggatgtgctggcgttgctggatgtgccggtgctggcg
gcgcggtttgacatcaccgaagaagggctgcgttatttacgccagtgggtcaacgaatcc
ggcattcgttggggcatagatgacgacaacgttcgcgagctggaactccccgccaccgga
caacacacctggcgatttggcctgacgcgtatgttgttgggctacgcgatggagagcgcg
cagggcgagtggcaatcggttctaccttatgatgaatcgagcggcttaattgcagaactg
gtggggcatctggcttcactgctaatgcagctaaacatctggcgtcgcgggctggcacag
gagcgtccgctggaagagtggttgccggtttgtcgcgatatgctcaacgccttcttcctg
ccggatgcggaaaccgaagcggcgatgacgctgatcgaacaacaatggcaggcgattatc
gccgaaggtttaggtgcgcagtatggcgacgcggtgccgctgtcactattgcgtgatgaa
ctggcacagcgtctggatcaagaacgtatcagccagcgttttctcgccggaccggttaac
atttgtactctgatgccaatgcgttcaattccgttcaaagtggtttgcctgctgggaatg
aacgacggcgtttatccacgtcagcttgcgccattgggctttgacctgatgagccagaaa
ccgaagcgtggcgaccgtagccgtcgcgatgacgaccgctatctgttcctggaagcgtta
atttccgcgcagcaaaaactctatatcagctatatcggtcgttccattcaggataacagt
gagcgtttcccgtcggtactggtgcaggaactgatcgactacatcgggcaaagtcattat
ctaccgggcgatgaagcgctcaactgtgatgaaagcgaggcaagggtaaaagcgcatctt
acttgcctccatacccggatgccgtttgatccacaaaactaccagccaggcgaacgacaa
agctatgctcgtgaatggctacctgcggccagccaggctggtaaagcacattctgaattt
gttcagccgctgccgtttaccttaccggaaaccgtgccgctggaaacgctacaacgattc
tgggcacatccggtgcgggcatttttccagatgcgtttgcaggtgaacttccgtactgaa
gacagcgaaatccccgacaccgagccatttattctggaaggacttagccgttatcaaatc
aatcagcagttattgaatgcactggttgagcaggatgatgccgaacgcttgttccgccgc
ttccgagcggcaggggatttaccgtatggcgcttttggtgaaattttctgggaaacacag
tgccaggagatgcagcagcttgccgacagagtcattgcctgtcgccagccggggcagagt
atggaaattgatctcgcctgcaacggtgtgcagataactggctggttgccgcaggtgcag
ccggatggcctgttgcgctggcgtccctctttattaagtgtggcccagggaatgcaactt
tggctggaacaccttgtctactgtgccagcggtggtaatggtgaaagtcgcctttttcta
cgcaaagacggcgagtggcgttttccgccgcttgcagccgaacaggctttgcattacctc
tcacaactgattgaggggtatcgtgaaggaatgtccgcgccattgctggtgttacctgaa
agtggcggcgcgtggctaaaaacctgttatgacgcgcaaaacgatgccatgctggatgac
gattccacgttgcaaaaagcccgtacgaaattccttcaggcttacgaaggcaacatgatg
gtgcgtggcgaaggtgatgatatctggtatcaaaggctctggcggcaattaacaccagag
acaatggaggccatcgttgaacagtcgcaacgtttcctgttaccgctgtttcgctttaat
cagtcatga
              
                            

Download fasta file
RegulonDB