RegulonDB RegulonDB 10.10: Gene Sequence
recE gene sequence


Size: 2601        A: 760  T: 556  G: 642  C: 643

Fasta

 

>recE E. coli K12. Version NC_000913.3 GI:556503834
atgagcacaaaaccactcttcctgttacggaaagcgaaaaaatcatccggtgaacctgac
gtcgtcctgtgggcaagcaacgattttgaatcgacctgtgccactctggactacctgatc
gttaagtcaggtaaaaaactgagcagctattttaaagctgttgccacgaattttcctgtc
gttaatgacctgcccgctgaaggtgagatcgattttacctggagtgaacgctatcaactc
agcaaagactccatgacatgggaactaaaaccgggagcagcaccagacaacgctcactat
caaggcaataccaacgtcaacggcgaagacatgactgagattgaggagaatatgctactc
ccaatttctggccaggaactgcccattcgttggcttgctcaacacggcagcgaaaaaccg
gtaacgcacgtttcacgcgacggactccaggcattacacattgctcgggctgaagaacta
ccggctgttactgccctggctgtttcccacaaaaccagcctgctcgacccgctggaaatt
cgcgaactccacaaactggttcgtgacactgacaaagttttccctaatcctggtaattca
aacctgggactgataactgcttttttcgaagcatacctgaacgctgactacaccgatcga
ggactgctgacaaaagagtggatgaagggtaatcgtgtttcacacatcactcgcacggct
tccggtgctaatgctggcggcggaaacctcaccgatcgcggcgaaggtttcgtacacgat
ctgacgtcactggcgcgcgacgtagccactggcgtactggcccgttcaatggatctggac
atctataaccttcatccggcacacgctaaacgcattgaggaaattatcgctgaaaataaa
ccgcccttttctgttttccgcgacaaattcatcaccatgcctggcgggctggattattcc
cgcgccatcgtggttgcgtccgtaaaagaagcaccaattgggatcgaggtcatccccgcg
cacgtcactgaatatctgaacaaagtactgactgaaaccgatcatgccaaccctgatccg
gaaatcgtggatattgcctgcggtcgctcctctgccccgatgccgcagcgagtaacagaa
gaaggaaaacaggatgatgaagaaaaaccgcaaccatctggaacaacggcagttgaacag
ggagaggctgaaacaatggaaccggacgcaactgaacatcatcaggacacgcagccgctg
gatgctcagtcacaggtaaattctgttgatgcgaaatatcaggaactgcgggcagaactc
catgaagcccggaaaaacattccatcaaaaaatcctgtcgatgacgataaattgcttgct
gcatcacgtggtgaatttgttgacggaattagcgacccgaacgatccgaaatgggtaaag
gggatccagactcgcgattgtgtgtaccagaaccagccagaaacggaaaaaaccagccca
gatatgaatcaacctgagccagtagtgcaacaggaaccggaaatagcctgcaatgcctgc
ggccagactggcggggataactgccctgactgtggtgcggtgatgggcgacgcaacatac
caggaaacattcgatgaagagagtcaggttgaagctaaggaaaatgatccggaggaaatg
gaaggcgctgaacatccgcacaatgagaatgctggcagcgatccgcatcgcgattgcagt
gatgaaactggcgaagtcgcagatcccgtaatcgtagaagacatagagccaggtatttat
tacggaatttcgaatgagaattaccacgcgggtcccggtatcagtaagtctcagctcgat
gacattgctgatactccggcactatatttgtggcgtaaaaatgcccccgtggacaccaca
aagacaaaaacgctcgatttaggaactgctttccactgccgggtacttgaaccggaagaa
ttcagtaaccgctttatcgtagcacctgaatttaaccgccgtacaaacgccggaaaagaa
gaagagaaagcgtttctgatggaatgcgcaagcacaggaaaaacggttatcactgcggaa
gaaggccggaaaattgaactcatgtatcaaagcgttatggctttgccgctggggcaatgg
cttgttgaaagcgccggacacgctgaatcatcaatttactgggaagatcctgaaacagga
attttgtgtcggtgccgtccggacaaaattatccctgaatttcactggatcatggacgtg
aaaactacggcggatattcaacgattcaaaaccgcttattacgactaccgctatcacgtt
caggatgcattctacagtgacggttatgaagcacagtttggagtgcagccaactttcgtt
tttctggttgccagcacaactattgaatgcggacgttatccggttgaaattttcatgatg
ggcgaagaagcaaaactggcaggtcaacaggaatatcaccgcaatctgcgaaccctgtct
gactgcctgaataccgatgaatggccagctattaagacattatcactgccccgctgggct
aaggaatatgcaaatgactaa
              
                            

Download fasta file
RegulonDB