RegulonDB RegulonDB 10.9: Gene Sequence
recR gene sequence


Size: 606        A: 125  T: 131  G: 185  C: 165

Fasta

 

>recR E. coli K12. Version NC_000913.3 GI:556503834
atgcaaaccagcccgctgttaacacagcttatggaagcactgcgctgtctgccgggcgtt
ggcccgaagtcggcgcagcgtatggcgttcacgctgcttcagcgcgatcgtagcggcggg
atgcgtctggcgcaggcgctcacccgggcgatgtcggaaatcggccactgcgccgattgc
cgcactttcaccgaacaggaagtctgtaacatctgttcgaatccgcgtcgtcaggaaaac
ggtcaaatctgcgtggtggagagtccggcggacatctacgccattgagcagacggggcag
ttttcaggtcgttattttgtgttgatggggcatctgtcaccgctggacggcatcggtccg
gatgatatcgggcttgatcgtctggaacagcgtctggcagaggaaaaaatcactgaagtg
atcctcgccaccaaccccacggttgaaggtgaagctaccgctaactacattgccgagctt
tgcgcgcaatatgacgtggaagccagccgaatcgctcatggcgttccggttggcggcgag
ctggaaatggtcgacggcaccacgttgtcacactcccttgccgggcgtcataagattcgt
ttttaa
              
                            

Download fasta file
RegulonDB