RegulonDB RegulonDB 10.9: Gene Sequence
relB gene sequence


Size: 240        A: 65  T: 62  G: 61  C: 52

Fasta

 

>relB E. coli K12. Version NC_000913.3 GI:556503834
atgggtagcattaacctgcgtattgacgatgaacttaaagcgcgttcttacgccgcgctt
gaaaaaatgggtgtaactccttctgaagcgcttcgtctcatgctcgagtatatcgctgac
aatgaacgcttgccgttcaaacagacactcctgagtgatgaagatgctgaacttgtggag
atagtgaaagaacggcttcgtaatcctaagccagtacgtgtgacgctggatgaactctga
              
                            

Download fasta file
RegulonDB