RegulonDB RegulonDB 10.9: Gene Sequence
fliD gene sequence


Size: 1407        A: 408  T: 264  G: 328  C: 407

Fasta

 

>fliD E. coli K12. Version NC_000913.3 GI:556503834
atggcaagtatttcatcgctgggagtcgggtcaggtctggatttaagttccatccttgat
agcctcaccgccgcgcaaaaagcgacgctaacccccatttcaaatcagcaatcgtcgttt
accgctaaacttagcgcctacggtacgctgaaaagcgcgctgacgactttccagaccgcc
aatactgcattgtctaaagccgatcttttttccgccaccagcaccaccagcagcaccacc
gcgttcagtgccaccactgcgggtaacgccatcgccgggaaatacaccatcagcgtcacc
catctggcgcaggcgcaaaccctgaccacgcgcaccaccagagacgatacgaaaacggcg
atcgccaccagcgacagtaaactcaccattcaacaaggcggcgacaaagatccgattacc
attgatatcagcgcggctaactcatcgttaagcgggatccgtgatgccatcaacaacgca
aaagcaggcgtaagcgcaagcatcattaacgtgggtaacggtgaatatcgtctgtcagtc
acatcaaatgacaccggccttgataatgcgatgacactctcggtcagcggtgatgatgcg
ctacaaagttttatgggctatgacgccagtgccagcagcaacggtatggaggtctcggtt
gccgcccagaatgcgcagctgacagtcaacaacgtcgccatcgagaacagcagcaacacc
atcagcgacgcgctggaaaacatcaccctgaacctgaacgatgtcaccacgggcaaccag
acgctaaccatcactcaggacacctccaaagcgcaaacggcgattaaagactgggtgaat
gcctacaactcgctaatagataccttcagcagcctgaccaaatacaccgccgtagatgcg
ggagctgatagccagagttctagcaatggtgcactgctcggcgactccacgctgcggacg
attcagacgcagttgaaatcgatgctgagtaataccgtcagttcttccagctataaaacg
ttggcgcagattggtatcacgaccgatcccagcgatggcaaactggaactggatgccgac
aaactcaccgctgcactgaaaaaagatgccagcggcgtaggtgcattgattgttggcgat
ggtaaaaaaaccggcatcacgaccaccatcggcagcaacctgaccagttggctttcgaca
acgggcattattaaagccgctaccgatggcgttagtaagaccctgaataaattaactaaa
gactacaacgccgccagcgatcgcattgatgcgcaggtcgctcgctacaaagaacaattt
acccaactggacgttttaatgacctcgttaaacagcaccagcagctacttaacgcagcag
ttcgaaaacaacagtaattccaagtaa
              
                            

Download fasta file
RegulonDB