RegulonDB RegulonDB 11.0: Gene Sequence
rhsC gene sequence


Size: 4194        A: 981  T: 732  G: 1277  C: 1204

Fasta

 

>rhsC E. coli K12. Version NC_000913.3 GI:556503834
atgagcggaaaaccggcggcgcgtcagggcgacatgacgcagtatggcggtagcattgtc
cagggttcagccggggtacgcatcggtgcccccaccggcgtggcctgttcggtgtgcccc
ggcggggtgacgtccggccatccggtcaatccgctgctcggtgcaaaggtccttcccggt
gaaaccgacatcgccctgcccggcccgctgccgttcattctctcccgcacctacagcagt
taccggacaaaaacgcccgcgccggtggggagcctcggccccggctggaaaatgcctgcg
gatatccgcttacagctgcgcgataacacactgatactcagtgataacggcggcagaagc
ctgtattttgagcacctgtttcccggtgaggacggttacagccgcagcgagtcactgtgg
ctggtgcgcggcggcgtggcgaaactggatgaaggtcaccggctggccgcactctggcag
gcgctgccggaagaactccgcttaagtccgcatcgttatctggcgacaaacagtccgcag
gggccgtggtggctgctcggctggtgtgagcgggtgccggaagcggatgaggtgctgcct
gcgccgctgccgccgtaccgggtactgaccgggctggtggaccgcttcgggcgcacacag
acgttccaccgcgaagccgccggtgaattcagcggcgaaatcaccggcgtgacggatggt
gccgggcgtcacttccggctggtactgaccacgcaggcgcagcgggcagaagaagcccgg
cagcaggccatttccggcgggacggaaccgtccgcttttcctgataccctgccgggttac
accgaatatggccgggacaacggcatccgtctgtctgccgtgtggctgacgcacgacccg
gaatacccggagaatttacctgccgcgccgctggtgcgctatggctggacgccccgcggc
gaactggcggcggtgtatgaccgcagcaatacacaggtgcgcagctttacttacgatgat
aaataccggggccggatggtggcgcaccgtcacacgggccgaccggaaatctgttaccgt
tacgacagcgacgggcgggtgacagaacagctaaacccggcaggcttaagttacacgtat
cagtatgagaaggaccgcatcaccatcaccgacagcctgaaccgccgtgaagtcctgcac
acgcagggtgaaggcgggctgaagcgggtggtgaaaaaggaacacgcggacggcagcgtc
acgcagagtcagtttgacgcggtgggcaggctcagggcacagacggatgccgcaggcagg
acaacagaatacagtccggatgtggtgacgggcctcatcacgcgcatcaccacgccggat
ggcagggcatcggcgttttactataaccaccacagccagttaacgtcagccaccgggcct
gacgggctggaaatacgccgggaatatgatgaatggggccgtctgattcaggaaactgcc
cctgacggcgatatcacccgctaccgttatgataatccacacagtgacttaccctgcgca
acggaagatgccaccggcagccggaaaaccatgacgtggagccgttacggtcagttgctg
agcttcactgactgttccggttatgtaacccgctatgaccatgaccgttttggtcaggtg
acggcggtgcaccgcgaggaagggctgagtcagtaccgcgcatacgacagccgtggacag
ttaattgccgtgaaagacacgcagggccatgaaacgcggtatgaatacaacgccgccggt
gacctgaccaccgtcattgccccggacggcagcagaaacgggacacagtacgatgcgtgg
ggaaaagccatctgtaccacgcagggcggtctgacgcgcagtatggaatacgatgctgcc
ggacgggtcatccgcctgaccagtgaaaacggcagccacaccaccttccgttacgatgta
ctcgaccggctgatacaggaaaccggctttgacggccgcacacagcgttatcaccacgac
ctgaccggcaaacttatccgcagcgaggatgaggggctggtcacccactggcactatgac
gaagcagaccgcctcacgcaccgcaccgtgaatggcgaaaccgcagagcggtggcagtat
gacgaacgcggctggctgacagacatcagccatatcagcgaagggcaccgggtgacggtg
cactatggttatgacagtaaaggccgcctcgccagtgaacacctgacggtgcatcatccg
cagacgaatgaactgctctggcagcatgagaccagacatgcgtacaacgcacagggactg
gcgaaccgctgtataccggacagcctgcccgccgtggaatggctgacctacggcagcggc
tggctgtcaggcatgaaactcggcgacacaccgctggtggagtacacccgcgaccgcctg
caccgggaaacgctgcgcagcttcggccgttatgaactcaccaccgcttatacccctgcc
gggcagttacagagccagcacctgaacagcctgctgtctgaccgcgattacacctggaac
gacaacggcgaactcatccgcatcagcagcccgcgccagacccggagttacagctacagc
accaccggcaggctgaccggcgttcacaccaccgcagcgaatctggatatccgcatcccg
tataccacagacccggcaggtaaccgcctgcccgacccggagctgcacccggacagcgcc
ctcagcatgtggccggataaccgtatcgcccgtgacgcgcactatctttaccggtatgac
cgtcacggcaggctgacagagaaaaccgacctcatcccggaaggggttatccgcacggat
gatgagcgcacccaccggtaccattacgacagtcagcaccggctggtgcactacacgcgg
acacaatatgcagagccgctggtcgaaagtcgctatctttacgacccgctgggccgcagg
gtggcaaaacgggtatggcggcgtgaacgggacctgacgggctggatgtcgctgtcacgg
aaaccgcaagtgacctggtacggctgggacggcgaccgcctgaccacgatacagaacgac
agaacccgcatccagacgatttatcagccggggagcttcacgccactcatcagggttgaa
accgccaccggtgagctggcgaaaacgcagcgccgcagcctggcggatacccttcagcag
tccggtggcgaagacggtggcagtgtggtgttcccgccggtgctggtgcagatgctcgac
cggctggaaagtgaaatcctggctgaccgggtgagtgaggaaagccgccgctggctggca
tcgtgcggcctgacggtggcgcagatgcaaagccagatggacccggtatacacgccggcg
cgaaaaattcacctgtaccactgcgaccatcgcggcctgccgctggcccttatcagcacg
gaagggacaacagcgtggtacgcagaatacgatgaatggggtaacctgctgaatgaagag
aacccgcatcagctgcagcagcttatccgcctgccggggcagcagtatgatgaggagtcc
ggcctgtattacaaccgccaccgctattatgacccgctgcaggggcgatatatcactcag
gatccgattgggctgaaagggggatggaatttttatcagtatccgttgaatccgatctca
aatatagatccattaggattagaaacactaaaatgcattaagccactgcattcaatgggc
ggaactggtgaaagaagcggtccagatatatgggggaatccgttctatcatcaatatctt
tgtgtcccagatggtaaaggggactatacttgtggtggccaagaccaacggggagaatca
aaaggagatggtctatgggggccaggtaaagcaagtaatgatacaaaagaagctgctggc
cgttgtgacctcgttgaaaccgataatagttgtgtggagaactgtttaaaagggaagttt
aaagaggtaaggccgcgttattctgtattgcctgatatattcacacctataaatttaggg
ctatttaaaaactgccaagactggtctaatgattctttagaaacatgtaagatgaagtgc
tccggaaataacattggacgttttattagatttgtattcaccggagtgatgtaa
              
                            

Download fasta file
RegulonDB