RegulonDB RegulonDB 10.10: Gene Sequence
rhsD gene sequence


Size: 4281        A: 976  T: 731  G: 1418  C: 1156

Fasta

 

>rhsD E. coli K12. Version NC_000913.3 GI:556503834
atgagcggaaaaccagcggcgcgtcagggagatatgactcagtatggcggtcccattgtc
cagggttcggcaggtgtaagaattggcgcgcccaccggcgtggcgtgctcggtgtgtccg
ggcgggatgacttcgggcaacccggtaaatccgctgctgggggcgaaggtgctgcccggc
gagacggaccttgcgctgcccggcccgctgccgttcattctctcccgcacctacagcagc
taccggacgaagacgcctgcaccggtgggcgttttcggccccggctggaaagcgccttct
gatatccgcttacagctacgtgatgacggactgatactcaacgacaacggcgggcggagc
attcactttgagccgctgctgccgggggaggcggtgtacagccgcagtgagtcaatgtgg
ctggtgcgcggtggtaaggcagcacagccggacggccatacgctggcgcggctgtggggg
gcgctgccgccggatatccggttaagcccgcatctttacctggcgaccaacagcgcacag
gggccgtggtggatactggggtggtctgagcgggtgccgggtgctgaggacgtactgcca
gcgccgctgccgccgtaccgggtgcttaccgggatggcggaccgcttcgggcggacgctg
acgtaccggcgtgaggccgccggtgacctggccggggaaatcaccggcgtgacggacggt
gccgggcgggagttccgtctggtgctgaccacgcaggcgcagcgtgcggaagaggcccgc
acctcttcgctatcttcttctgacagttcccgccctctctcagcctcagcgttccccgac
acactgcccggtaccgaatacggccccgacaggggtatccgcctttcggcggtgtggctg
atgcacgacccggcatacccggagagcctgcccgctgcgccactggtgcggtacacgtat
acggaagccggtgaactgctggcggtatatgaccgcagcaatacgcaggtgcgcgctttc
acgtatgacgcgcagcacccgggccggatggtggcgcaccgttacgcgggaaggccggag
atgcgctaccgctacgacgatacggggcgggtggtggagcaactgaacccggcagggtta
agctaccgctatctttatgagcaggaccgcatcaccgtcaccgacagcctgaaccggcgt
gaggtgctgcatacagaaggcggggccgggctgaaacgggtggtgaaaaaagaactggcg
gacggcagcgtcacgcgcagcgggtatgacgcggcaggaaggctcacggcgcagacggac
gcggcgggacggaggacagagtacggtctgaatgtggtgtccggcgatatcacggacatc
accacaccggacgggcgggagacgaaattttactataacgacgggaaccagctgacggcg
gtggtgtccccggacgggctggagagccgccgggaatatgatgaaccgggcaggctggta
tcggagacatcgcgcagcggggagacagtacgctaccgctacgatgacgcgcacagtgag
ttaccggcgacgacaacggatgcgacgggcagcacccggcagatgacctggagccgctac
gggcagttgctggcgttcaccgactgctcgggctaccagacccgttatgaatacgaccgc
ttcggccagatgacggcggtccaccgcgaggaaggcatcagcctttaccgccgctatgac
aaccgtggccggttaacctcggtgaaagacgcacagggccgtgaaacgcggtatgaatac
aacgccgcaggcgacctgactgccgttatcaccccggacggcaaccggagcgagacacag
tacgatgcgtggggaaaggcggtcagcaccacgcagggcgggctgacgcgcagtatggag
tacgatgctgccggacgtgtcatcagcctgaccaacgagaacggcagccacagcgtcttc
agttacgatgcgctggaccggctggtacagcagggcggctttgacgggcggacgcaacgt
tatcattatgacctgaccggaaaactcacacagagtgaggatgagggacttgtcatcctc
tggtactacgatgaatcggaccgtatcactcaccgcacggtgaacggcgaaccggcagag
cagtggcagtatgatggccacggctggctgacagacatcagccacctgagcgaaggccac
cgtgttgccgtccactatggctatgacgataaaggccgcctgaccggcgaatgccagacg
gtggagaacccggagacgggggaactgctgtggcagcatgagacgaaacacgcatacaac
gagcaggggctggcaaaccgcgtcacgccggacagcctgccgccggtggagtggctgacg
tatggcagcggttacctggcgggaatgaagctgggcgggacgccgctggtcgagtatacg
cgggacaggctgcaccgtgagacggtgcgcagcttcggcagcatggcaggcagtaatgcc
gcatacgaactgaccagcacatacacccccgcaggccagttacagagccagcacctgaac
agcctggtatatgaccgtgactacgggtggagtgacaacggcgacctggtgcgcatcagc
ggcccgcgacagacgcgggaatacggctacagcgccacgggcaggctggagagtgtgcgc
accctcgcaccagacctggacatccgcatcccgtatgccacggacccggcgggcaaccgg
ctgccggacccggagctgcacccggacagtacactcacagtgtggccggataaccgcatc
gcggaggatgcgcactatgtctaccgccacgatgaatacggcaggctgacggagaagacg
gaccgcatcccggcgggtgtgatacggacggacgacgagcggacccaccactaccactac
gacagccagcaccgcctggtgttctacacgcggatacagcatggcgagccactggtcgag
agccgctacctctacgacccgctgggacggcgaatggcaaaacgggtctggcggcgggag
cgtgacctgacggggtggatgtcgctgtcgcgtaaaccggaggtgacgtggtatggctgg
gacggagacaggctgacgacggtgcagactgacaccacacgtatccagacggtatacgag
ccgggaagcttcacgccgctcatccgggtcgagacagagaacggcgagcgggaaaaagcg
cagcggcgcagcctggcagagacgctccagcaggaagggagtgagaacggccacggcgtg
gtgttcccggctgaactggtgcggctgctggacaggctggaggaagaaatccgggcagac
cgcgtgagcagtgaaagccgggcgtggcttgcgcagtgcgggctgacggtggagcaactg
gccagacaggtggagccggaatacacaccggcgcgaaaagctcatctttatcactgcgac
caccggggactgccgctggcgcttatcagcgaagacggcaatacggcgtggagcgcggaa
tatgatgaatggggcaaccagcttaatgaggagaacccgcatcatgtgtatcagccgtac
cgtctgccagggcagcagcatgatgaggaatcagggctgtactataaccgtcaccggtac
tacgatccgttgcaggggcggtatattactcaggacccgatggggttgaaagggggatgg
aatttatatcagtatcctttaaatccactacaacaaattgaccctatgggattattgcag
acttgggatgatgccagatctggagcatgtacggggggagtttgtggtgttctttcacgt
ataataggaccaagtaaatttgatagtactgcagatgctgcgttagatgctttgaaagaa
acgcagaatagatctctatgtaatgatatggaatactctggtattgtctgtaaagatact
aatggaaaatattttgcatctaaggcagaaactgataatttaagaaaggagtcatatcct
ctgaaaagaaaatgtcccacaggtacagatagagttgctgcttatcatactcacggtgca
gatagtcatggcgattatgttgatgaatttttttcaagtagcgataaaaatcttgtaaga
agtaaagataataatcttgaagcattttatctcgcaacacctgatggacgatttgaggcg
cttaataataaaggagaatatatttttatcagaaatagtgtcccgggattgagttcagta
tgcataccgtatcatgattaa
              
                            

Download fasta file
RegulonDB