RegulonDB RegulonDB 10.8: Gene Sequence
rimK gene sequence


Size: 903        A: 192  T: 203  G: 288  C: 220

Fasta

 

>rimK E. coli K12. Version NC_000913.3 GI:556503834
gtgaaaattgccatattgtcccgggatggaacgctctattcgtgtaagcggctgcgtgaa
gccgctatacagcgcggtcacctggttgaaattcttgatccgctttcttgctacatgaac
ataaatcctgcggcgtcttctattcactacaaaggccgcaagttaccccattttgacgca
gtgatcccgcgtattggcaccgccattaccttttatgggacggcggcactgcgccagttc
gagatgctggggagctatccgctcaatgagtcggtcgccattgcccgggcgcgtgacaaa
ttgcgttccatgcaactgctggcgcgtcagggcatcgacctgcctgtcacgggcattgcg
cattcgccggatgataccagcgatttaatcgacatggtcggtggtgcgccgctggtggtc
aagttggttgaaggcacgcagggaattggcgtcgtgctggcggagacgcgtcaggcggcg
gaaagcgtgattgacgctttccgcggtctgaacgcgcatattctggtgcaggaatatatc
aaagaggcgcaagggtgcgatatccgctgtctggttgttggcgatgaagtggtcgctgcg
attgaacggcgggcgaaagagggcgattttcgttccaatttgcatcgtggcggcgcggca
agcgtcgccagtatcacaccacaggagcgtgaaatcgcgataaaagccgcgcgaacgatg
gcgctggacgttgctggtgtggatattctgcgtgctaatcgcgggccgttggtgatggag
gtgaatgcgtcgccggggctggaaggaatagaaaaaaccaccggtatcgacatcgcgggt
aaaatgatccgctggatcgaacgccacgctacgacagaatattgcctgaaaacgggtggt
tag
              
                            

Download fasta file
RegulonDB