RegulonDB RegulonDB 10.9: Gene Sequence
rimL gene sequence


Size: 540        A: 163  T: 143  G: 125  C: 109

Fasta

 

>rimL E. coli K12. Version NC_000913.3 GI:556503834
atgactgaaacgataaaagtaagcgaatcacttgaattacatgctgttgcagaaaatcac
gtcaaacctctttatcagttaatctgtaaaaataaaacctggttacagcagtcgctaaac
tggccgcagtttgttcaaagtgaagaggacacgcgaaaaacggtgcagggtaatgtgatg
ttgcatcaacgcggctatgccaaaatgttcatgattttcaaagaagatgaacttatcggc
gttatctcgtttaatcgtattgaaccactgaataaaaccgctgaaataggctactggctg
gacgaatctcatcaggggcaggggatcatttctcaggcgctgcaggcattgattcatcat
tacgcccagtctggtgaacttagacgcttcgtgatcaaatgtcgggtggacaatccgcaa
agcaaccaggtcgctttgcgcaatggttttatccttgaaggttgcctgaaacaggctgag
ttcctgaatgatgcctatgatgatgtgaacttatacgcgcgtattatcgattcacaataa
              
                            

Download fasta file
RegulonDB