RegulonDB RegulonDB 11.1: Gene Sequence
rlpA gene sequence


Size: 1089        A: 256  T: 209  G: 297  C: 327

Fasta

 

>rlpA E. coli K12. Version NC_000913.3 GI:556503834
atgcgtaagcagtggctcgggatctgcatcgcggcaggaatgctcgcggcatgtacaagc
gatgatggtcagcaacagacggtaagtgtaccgcagcctgcggtatgtaacggccctata
gttgaaattagcggggcggacccgcgtttcgaaccactgaacgcgacggcaaatcaggat
taccagcgcgacggtaaaagctacaaaatcgtgcaggatccgtctcgatttagccaggcg
ggactggcggcaatctatgatgccgaacccggcagtaacctgacggcctctggcgaagca
ttcgatccgacacagctgacggcagcccatccaacgcttccgatccccagctacgccaga
atcactaacctggctaacgggcgaatgatcgtggtgcgcattaatgatcgcggcccttac
ggcaacgaccgcgttatttcactttctcgcgcggcagctgaccgtcttaacacgtcaaac
aacaccaaagttcgtatcgatccgattattgttgcccaggatggttcgctttctggtcct
ggtatggcttgtaccacagtcgccaaacagacttacgccctgcctgcacctcccgattta
agcggtggcgcgggaacaagttcagtgtctggcccgcagggtgacattcttccggtcagt
aattcgacgctaaaaagcgaagatccgaccggcgcgccggtaaccagtagcggtttcctc
ggcgcaccaacgaccttagcgcctggtgtactggaaggcagcgaaccgacgcctgcgcca
cagcccgttgttacagctccgtcgacaacgcctgcaacctcgcctgcaatggtgacaccg
caagccgtctcgcaaagcgccagcggcaactttatggtgcaagtcggggccgtaagcgat
caggctcgtgcgcaacagtaccaacagcaactgggacagaagttcggcgtccccggtcgc
gtaactcaaaatggcgcggtctggcggatccagcttggcccattcgccagcaaagccgaa
gccagtaccttgcagcaacgtttgcaaaccgaagcccaattacagtcatttattactacc
gcgcagtag
              
                            

Download fasta file
RegulonDB