RegulonDB RegulonDB 10.9: Gene Sequence
lptE gene sequence


Size: 582        A: 145  T: 133  G: 154  C: 150

Fasta

 

>lptE E. coli K12. Version NC_000913.3 GI:556503834
gtgcgatatctggcaacattgttgttatctctggcggtgttaatcaccgccgggtgtggc
tggcatctgcgtgataccacgcaggttccttccactatgaaggtcatgatcctggactca
ggcgatccgaacgggccattaagccgtgcggtgcgtaaccagttacgtctgaatggtgtc
gagttgcttgataaagaaaccacgcgtaaggacgttccatccttgcgtttgggtaaagtg
agcatcgcgaaagataccgcatcggtattccgtaacggtcaaacagcagagtatcagatg
atcatgacggttaatgcgaccgtgttgatccccggccgtgatatctacccgattagcgcc
aaagtcttccgttcgttcttcgataacccgcaaatggcgttagcgaaagataacgaacaa
gacatgatcgtaaaagagatgtacgaccgtgctgccgaacagctgattcgtaagctgcca
agcatccgtgctgcggatattcgttccgacgaagaacagacgtcgaccacaacggatact
ccggcaacgcctgcacgcgtctccaccacgctgggtaactga
              
                            

Download fasta file
RegulonDB