RegulonDB RegulonDB 10.9: Gene Sequence
rnhB gene sequence


Size: 597        A: 130  T: 125  G: 184  C: 158

Fasta

 

>rnhB E. coli K12. Version NC_000913.3 GI:556503834
atgatcgaatttgtttatccgcacacgcagctggttgcgggtgtggatgaagtcggacgc
gggccgttagttggcgcggtcgtcaccgctgcggtgatccttgacccggcgcgcccgatt
gccgggctgaatgattccaaaaagctgagcgaaaaacgccgtctggcgctctatgaagag
atcaaagagaaagcgttgagctggagtctgggccgcgcggaaccccacgaaatcgacgag
ctgaacattcttcatgcgaccatgctggcgatgcagcgtgccgtcgctgggctgcatatt
gcgccggaatatgtgttgattgatggtaaccgctgcccgaaattaccgatgcctgcgatg
gctgtggtgaaaggcgatagccgcgtaccggaaatcagtgccgcgtctatcctggcgaaa
gtgacgcgtgacgccgaaatggcggcgctggatattgttttcccgcaatatggttttgcc
caacacaaagggtacccaaccgcttttcatctggaaaaactggctgaacacggcgcgacc
gaacaccatcggcgcagctttgggcctgtcaaacgcgcactgggacttgcgtcctga
              
                            

Download fasta file
RegulonDB