RegulonDB RegulonDB 10.9: Gene Sequence
rplS gene sequence


Size: 348        A: 88  T: 92  G: 90  C: 78

Fasta

 

>rplS E. coli K12. Version NC_000913.3 GI:556503834
atgagcaacattattaagcaacttgaacaagagcagatgaagcaggacgtaccttccttc
cgtccgggtgataccgtggaagtgaaagtatgggttgttgaaggttccaaaaaacgtctg
caggcattcgagggcgtggttatcgctattcgtaaccgcggtctgcactctgcattcact
gttcgtaaaatttccaacggcgaaggcgttgagcgtgtcttccagactcactctccggta
gttgacagcatttctgtcaaacgtcgtggtgctgttcgtaaagctaaactgtactacctg
cgtgagcgtactggtaaggctgctcgtatcaaagagcgtcttaactaa
              
                            

Download fasta file
RegulonDB