RegulonDB RegulonDB 10.9: Gene Sequence
rplY gene sequence


Size: 285        A: 85  T: 56  G: 72  C: 72

Fasta

 

>rplY E. coli K12. Version NC_000913.3 GI:556503834
atgtttactatcaacgcagaagtacgtaaagagcagggtaagggtgcgagccgccgcctg
cgtgccgctaacaagttcccggcaatcatctacggtggcaaagaagcgccgctggctatc
gagctggatcacgacaaagtcatgaacatgcaagctaaagctgaattctacagcgaagtt
ctgaccatcgttgttgacggtaaagaaatcaaagttaaagctcaggacgtacagcgtcac
ccgtacaaaccgaagctgcagcacatcgacttcgttcgcgcttaa
              
                            

Download fasta file
RegulonDB