RegulonDB RegulonDB 10.9: Gene Sequence
rpmF gene sequence


Size: 174        A: 48  T: 32  G: 38  C: 56

Fasta

 

>rpmF E. coli K12. Version NC_000913.3 GI:556503834
atggccgtacaacagaataaaccaacccgttccaaacgtggcatgcgtcgttcccatgac
gcgctgaccgcagtcaccagcctgtctgtagacaaaacttctggtgaaaaacacctgcgt
caccacatcactgccgacggttactaccgcggccgcaaggtcatcgctaagtaa
              
                            

Download fasta file
RegulonDB