RegulonDB RegulonDB 10.9: Gene Sequence
rpsK gene sequence


Size: 390        A: 95  T: 94  G: 99  C: 102

Fasta

 

>rpsK E. coli K12. Version NC_000913.3 GI:556503834
atggcaaaggcaccaattcgtgcacgtaaacgtgtaagaaaacaagtctctgacggcgtg
gctcatatccatgcttctttcaacaacaccatcgtgactatcactgatcgtcagggtaac
gcgttgggttgggcaacagccggtggttccggtttccgtggttctcgcaaatccactccg
tttgcagctcaggttgcagcagagcgttgcgctgacgccgtgaaagaatacggcatcaag
aatctggaagttatggttaaaggtccgggtccaggccgcgaatctactattcgtgctctg
aacgccgcaggtttccgcatcactaacattactgatgtgactccgatccctcataacggt
tgtcgtccgccgaaaaaacgtcgcgtataa
              
                            

Download fasta file
RegulonDB