RegulonDB RegulonDB 10.9: Gene Sequence
rpsP gene sequence


Size: 249        A: 62  T: 59  G: 64  C: 64

Fasta

 

>rpsP E. coli K12. Version NC_000913.3 GI:556503834
atggtaactattcgtttagcacgtcacggcgctaaaaagcgtccgttctaccaggttgtt
gtcgctgacagccgtaatgcacgcaacggtcgcttcatcgagcgcgttggtttcttcaac
ccaatcgctagcgaaaaagaagaaggcactcgcctggatctggatcgcatcgctcactgg
gttggccagggcgcaactatttctgatcgcgttgctgcgctgatcaaagaagtaaacaaa
gcagcttaa
              
                            

Download fasta file
RegulonDB