RegulonDB RegulonDB 10.9: Gene Sequence
ruvC gene sequence


Size: 522        A: 119  T: 111  G: 156  C: 136

Fasta

 

>ruvC E. coli K12. Version NC_000913.3 GI:556503834
atggctattattctcggcattgatccgggttcgcgcgtgaccggctacggcgtcatccgc
caggtaggtaggcaactgtcctacctgggtagcggatgcatccgcaccaaagtggatgat
ttaccgtctcgtctgaaactcatctatgcgggcgtgacggaaatcatcacccagttccag
cctgattatttcgccattgaacaagtctttatggcaaagaacgctgactcagccctgaaa
ctgggccaggcgcgcggcgtggcgattgtggcggcggtgaatcaggagttgccagtattt
gaatacgcggcacgtcaggtaaagcaaacggtggtaggtattggcagtgccgaaaaaagc
caggtgcagcatatggtccgcaccttgctgaaactgcccgctaatccacaggcggatgcc
gccgatgcgctggcgattgctatcacccactgccacgttagtcagaatgcgatgcagatg
agcgaatcgcggctgaacctggcgagagggcgactgcgttaa
              
                            

Download fasta file
RegulonDB