RegulonDB RegulonDB 10.8: Gene Sequence
sbcB gene sequence


Size: 1428        A: 369  T: 344  G: 365  C: 350

Fasta

 

>sbcB E. coli K12. Version NC_000913.3 GI:556503834
atgatgaatgacggtaagcaacaatctacctttttgtttcacgattacgaaacctttggc
acgcaccccgcgttagatcgccctgcacagttcgcagccattcgcaccgatagcgaattc
aatgtcatcggcgaacccgaagtcttttactgcaagcccgctgatgactatttaccccag
ccaggagccgtattaattaccggtattaccccgcaggaagcacgggcgaaaggagaaaac
gaagccgcgtttgccgcccgtattcactcgctttttaccgtaccgaagacctgtattctg
ggctacaacaatgtgcgtttcgacgacgaagtcacacgcaacattttttatcgtaatttc
tacgatccttacgcctggagctggcagcatgataactcgcgctgggatttactggatgtt
atgcgtgcctgttatgccctgcgcccggaaggaataaactggcctgaaaatgatgacggt
ctaccgagctttcgccttgagcatttaaccaaagcgaatggtattgaacatagcaacgcc
cacgatgcgatggctgatgtgtacgccactattgcgatggcaaagctggtaaaaacgcgt
cagccacgcctgtttgattatctctttacccatcgtaataaacacaaactgatggcgttg
attgatgttccgcagatgaaacccctggtgcacgtttccggaatgtttggagcatggcgc
ggcaataccagctgggtggcaccgctggcgtggcatcctgaaaatcgcaatgccgtaatt
atggtggatttggcaggagacatttcgccattactggaactggatagcgacacattgcgc
gagcgtttatataccgcaaaaaccgatcttggcgataacgccgccgttccggttaagctg
gtgcatatcaataaatgtccggtgctggcccaggcgaatacgctacgcccggaagatgcc
gaccgactgggaattaatcgtcagcattgcctcgataacctgaaaattctgcgtgaaaat
ccgcaagtgcgcgaaaaagtggtggcgatattcgcggaagccgaaccgtttacgccttca
gataacgtggatgcacagctttataacggctttttcagtgacgcagatcgtgcagcaatg
aaaattgtgctggaaaccgagccgcgtaatttaccggcactggatatcacttttgttgat
aaacggattgaaaagctgttgttcaattatcgggcacgcaacttcccggggacgctggat
tatgccgagcagcaacgctggctggagcaccgtcgccaggtcttcacgccagagtttttg
cagggttatgctgatgaattgcagatgctggtacaacaatatgccgatgacaaagagaaa
gtggcgctgttaaaagcactttggcagtacgcggaagagattgtctaa
              
                            

Download fasta file
RegulonDB