RegulonDB RegulonDB 10.10: Gene Sequence
sbcC gene sequence


Size: 3147        A: 886  T: 568  G: 849  C: 844

Fasta

 

>sbcC E. coli K12. Version NC_000913.3 GI:556503834
atgaaaattctcagcctgcgcctgaaaaacctgaactcattaaaaggcgaatggaagatt
gatttcacccgcgagccgttcgccagcaacgggctgtttgctattaccggcccaacaggt
gcggggaaaaccaccctgctggacgccatttgtctggcgctgtatcacgaaactccgcgt
ctctctaacgtttcacaatcgcaaaatgatctcatgacccgcgataccgccgaatgtctg
gcggaggtggagtttgaagtgaaaggtgaagcgtaccgtgcattctggagccagaatcgg
gcgcgtaaccaacccgacggtaatttgcaggtgccacgcgtagagctggcgcgctgcgcc
gacggcaaaattctcgccgacaaagtgaaagataagctggaactgacagcgacgttaacc
gggctggattacgggcgcttcacccgttcgatgctgctttcgcaggggcaatttgctgcc
ttcctgaatgccaaacccaaagaacgcgcggaattgctcgaggagttaaccggcactgaa
atctacgggcaaatctcggcgatggtttttgagcagcacaaatcggcccgcacagagctg
gagaagctgcaagcgcaggccagcggcgtcacgttgctcacgccggaacaagtgcaatcg
ctgacagcgagtttgcaggtacttactgacgaagaaaaacagttaattaccgcgcagcag
caagaacaacaatcgctaaactggttaacgcgtcaggacgaattgcagcaagaagccagc
cgccgtcagcaggccttgcaacaggcgttagccgaagaagaaaaagcgcaacctcaactg
gcggcgcttagtctggcacaaccggcacgaaatcttcgtccacactgggaacgcatcgca
gaacacagcgcggcgctggcgcatattcgccagcagattgaagaagtaaatactcgctta
cagagcacaatggcgcttcgcgcgagcattcgccaccacgcggcgaagcagtcagcagaa
ttacagcagcagcaacaaagcctgaatacctggttacaggaacacgaccgcttccgtcag
tggaacaacgaaccggcgggttggcgtgcgcagttctcccaacaaaccagcgatcgcgag
catctgcggcaatggcagcaacagttaacccatgctgagcaaaaacttaatgcgcttgcg
gcgatcacgttgacgttaaccgccgatgaagttgctaccgccctggcgcaacatgctgag
caacgcccactgcgtcagcacctggtcgcgctgcatggacagattgttccccaacaaaaa
cgtctggcgcagttacaggtcgctatccagaatgtcacgcaagaacagacgcaacgtaac
gccgcacttaacgaaatgcgccagcgttataaagaaaagacgcagcaacttgccgatgtg
aaaaccatttgcgagcaggaagcgcgcatcaaaacgctggaagctcaacgtgcacagtta
caggcgggtcagccttgcccactttgtggttccaccagccacccggcggtcgaggcgtat
caggcgctggagcctggcgttaatcagtctcgattactggcgctggaaaacgaagttaaa
aagctcggtgaagaaggtgcgacgctacgtgggcaactggacgccataacaaagcagctt
cagcgtgatgaaaacgaagcgcaaagcctccgacaagatgagcaagcacttactcaacaa
tggcaagccgtcacggccagcctcaatatcaccttgcagccactggacgatattcaaccg
tggctggatgcacaagatgagcacgaacgccagctgcggttactcagccaacggcatgaa
ttacaagggcagattgccgcgcataatcagcaaattatccagtatcaacagcaaattgaa
caacgccagcaactacttttaacgacattgacgggttatgcactgacattgccacaggaa
gatgaagaagagagctggttggcgacacgtcagcaagaagcgcagagctggcagcaacgc
cagaacgaattaaccgcgctgcaaaaccgtattcagcagctgacgccgattctggaaacg
ttgccgcaaagtgatgaactcccgcactgcgaagaaactgtggtattggaaaactggcgg
caggtacatgaacaatgtctcgcattacacagccagcagcagacgttacagcaacaggat
gttctggcggcgcaaagtctgcaaaaagcccaggcgcagtttgacaccgcgctacaggcc
agcgtctttgacgatcagcaggcgttccttgcggcgctaatggatgaacaaacactaacg
cagctggaacagctcaagcagaatctggaaaaccagcgccgtcaggcgcaaactctggtc
actcagacagcagaaacgctggcacagcatcaacaacaccgacctgacgacgggttggct
ctcactgtgacggtggagcagattcagcaagagttagcgcaaactcaccaaaagttgcgt
gaaaacaccacgagtcaaggcgagattcgccagcagctgaagcaggatgcagataaccgt
cagcaacaacaaaccttaatgcagcaaattgctcaaatgacgcagcaggttgaggactgg
ggatatctgaattcgctaataggttccaaagagggcgataaattccgcaagtttgcccag
gggctgacgctggataatttagtccatctcgctaatcagcaacttacccggctgcacggg
cgctatctgttacagcgcaaagccagcgaggcgctggaagtcgaggttgttgatacctgg
caggcagatgcggtacgcgatacccgtaccctttccggcggcgaaagtttcctcgttagt
ctggcgctggcgctggcgctttcggatctggtcagccataaaacacgtattgactcgctg
ttccttgatgaaggttttggcacgctggatagcgaaacgctggataccgcccttgatgcg
ctggatgccctgaacgccagtggcaaaaccatcggtgtgattagccacgtagaagcgatg
aaagagcgtattccggtgcagatcaaagtgaaaaagatcaacggcctgggctacagcaaa
ctggaaagtacgtttgcagtgaaataa
              
                            

Download fasta file
RegulonDB