RegulonDB RegulonDB 10.9: Gene Sequence
sdaA gene sequence


Size: 1365        A: 309  T: 319  G: 394  C: 343

Fasta

 

>sdaA E. coli K12. Version NC_000913.3 GI:556503834
gtgattagtctattcgacatgtttaaggtggggattggtccctcatcttcccataccgta
gggcctatgaaggcaggtaaacagttcgtcgatgatctggtcgaaaaaggcttactggat
agcgttactcgcgttgccgtggacgtttatggttcactgtcgctgacgggtaaaggccac
cacaccgatatcgccattattatgggtcttgcaggtaacgaacctgccaccgtggatatc
gacagtattcccggttttattcgcgacgtagaagagcgcgaacgtctgctgctggcacag
ggacggcatgaagtggatttcccgcgcgacaacgggatgcgttttcataacggcaacctg
ccgctgcatgaaaacggtatgcaaatccacgcctataacggcgatgaagtcgtctacagc
aaaacttattattccatcggcggcggttttatcgtcgatgaagaacactttggtcaggat
gctgccaacgaagtaagcgtgccgtatccgttcaaatctgccaccgaactgctcgcgtac
tgtaatgaaaccggctattcgctgtctggtctcgctatgcagaacgaactggcgctgcac
agcaagaaagagatcgacgagtatttcgcgcatgtctggcaaaccatgcaggcatgtatc
gatcgcgggatgaacaccgaaggtgtactgccaggcccgctgcgcgtgccacgtcgtgcg
tctgccctgcgccggatgctggtttccagcgataaactgtctaacgatccgatgaatgtc
attgactgggtaaacatgtttgcgctggcagttaacgaagaaaacgccgccggtggtcgt
gtggtaactgcgccaaccaacggtgcctgcggtatcgttccggcagtgctggcttactat
gaccactttattgaatcggtcagcccggacatctatacccgttactttatggcagcgggc
gcgattggtgcattgtataaaatgaacgcctctatttccggtgcggaagttggttgccag
ggcgaagtgggtgttgcctgttcaatggctgctgcgggtcttgcagaactgctgggcggt
agcccggaacaggtttgcgtggcggcggaaattggcatggaacacaaccttggtttaacc
tgcgacccggttgcagggcaggttcaggtgccgtgcattgagcgtaatgccattgcctct
gtgaaggcgattaacgccgcgcggatggctctgcgccgcaccagtgcaccgcgcgtctcg
ctggataaggtcatcgaaacgatgtacgaaaccggtaaggacatgaacgccaaataccgc
gaaacctcacgcggtggtctggcaatcaaagtccagtgtgactaa
              
                            

Download fasta file
RegulonDB