RegulonDB RegulonDB 10.9: Gene Sequence
sdhA gene sequence


Size: 1767        A: 387  T: 385  G: 528  C: 467

Fasta

 

>sdhA E. coli K12. Version NC_000913.3 GI:556503834
atgaaattgccagtcagagaatttgatgcagttgtgattggtgccggtggcgcaggtatg
cgcgcggcgctgcaaatttcccagagcggccagacctgtgcgctgctctctaaagtcttc
ccgacccgttcccataccgtttctgcgcaaggcggcattaccgttgcgctgggtaatacc
catgaagataactgggaatggcatatgtacgacaccgtgaaagggtcggactatatcggt
gaccaggacgcgattgaatatatgtgtaaaaccgggccggaagcgattctggaactcgaa
cacatgggcctgccgttctcgcgtctcgatgatggtcgtatctatcaacgtccgtttggc
ggtcagtcgaaaaacttcggcggcgagcaggcggcacgcactgcggcagcagctgaccgt
accggtcacgcactgttgcacacgctttatcagcagaacctgaaaaaccacaccaccatt
ttctccgagtggtatgcgctggatctggtgaaaaaccaggatggcgcggtggtgggttgt
accgcactgtgcatcgaaaccggtgaagtggtttatttcaaagcccgcgctaccgtgctg
gcgactggcggagcagggcgtatttatcagtccaccaccaacgcccacattaacaccggc
gacggtgtcggcatggctatccgtgccggcgtaccggtgcaggatatggaaatgtggcag
ttccacccgaccggcattgccggtgcgggcgtactggtcaccgaaggttgccgtggtgaa
ggcggttatctgctgaacaaacatggcgaacgttttatggagcgttatgcgccgaacgcc
aaagacctggcgggccgtgacgtggttgcgcgttccatcatgatcgaaatccgtgaaggt
cgcggctgtgatggtccgtgggggccacacgcgaaactgaaactcgatcacctgggtaaa
gaagttctcgaatcccgtctgccgggtatcctggagctttcccgtaccttcgctcacgtc
gatccggtgaaagagccgattccggttatcccaacctgtcactacatgatgggcggtatt
ccgaccaaagttaccggtcaggcactgactgtgaatgagaaaggcgaagatgtggttgtt
ccgggactgtttgccgttggtgaaatcgcttgtgtatcggtacacggcgctaaccgtctg
ggcggcaactcgctgctggacctggtggtctttggtcgcgcggcaggtctgcatctgcaa
gagtctatcgccgagcagggcgcactgcgcgatgccagcgagtctgatgttgaagcgtct
ctggatcgcctgaaccgctggaacaataatcgtaacggtgaagatccggtggcgatccgt
aaagcgctgcaagaatgtatgcagcataacttctcggtcttccgtgaaggtgatgcgatg
gcgaaagggcttgagcagttgaaagtgatccgcgagcgtctgaaaaatgcccgtctggat
gacacttccagcgagttcaacacccagcgcgttgagtgcctggaactggataacctgatg
gaaacggcgtatgcaacggctgtttctgccaacttccgtaccgaaagccgtggcgcgcat
agccgcttcgacttcccggatcgtgatgatgaaaactggctgtgccactccctgtatctg
ccagagtcggaatccatgacgcgccgaagcgtcaacatggaaccgaaactgcgcccggca
ttcccgccgaagattcgtacttactaa
              
                            

Download fasta file
RegulonDB