RegulonDB RegulonDB 10.9: Gene Sequence
sdhB gene sequence


Size: 717        A: 167  T: 180  G: 193  C: 177

Fasta

 

>sdhB E. coli K12. Version NC_000913.3 GI:556503834
atgagactcgagttttcaatttatcgctataacccggatgttgatgatgctccgcgtatg
caggattacaccctggaagcggatgaaggtcgcgacatgatgctgctggatgcgcttatc
cagctaaaagagaaagatcccagcctgtcgttccgccgctcctgccgtgaaggtgtgtgc
ggttccgacggtctgaacatgaacggcaagaatggtctggcctgtattaccccgatttcg
gcactcaaccagccgggcaagaagattgtgattcgcccgctgccaggtttaccggtgatc
cgcgatttggtggtagacatgggacaattctatgcgcaatatgagaaaattaagccttac
ctgttgaataatggacaaaatccgccagctcgcgagcatttacagatgccagagcagcgc
gaaaaactcgacgggctgtatgaatgtattctctgcgcatgttgttcaacctcttgtccg
tctttctggtggaatcccgataagtttatcggcccggcaggcttgttagcggcatatcgt
ttcctgattgatagccgtgataccgagactgacagccgcctcgacggtttgagtgatgca
ttcagcgtattccgctgtcacagcatcatgaactgcgtcagtgtatgtccgaaggggctg
aacccgacgcgcgccatcggccatatcaagtcgatgttgttgcaacgtaatgcgtaa
              
                            

Download fasta file
RegulonDB